Microarray analysis of gene expression induced by Phytophthora infestans in tomato leaves
Ontology highlight
ABSTRACT:
ORGANISM(S): Solanum lycopersicum
SUBMITTER: Muna Sultan
PROVIDER: E-GEOD-33177 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Phytophthora infestans is most notorious oomycete causing a devastating disease on tomato called late blight. The molecular mechanisms involved in host-parasite interaction is still unexplored well. Investigation of changes in gene expression profile after pathogen infection to find out the mechanisms involved in infection process
2011-10-25 | GSE33177 | GEO
Project description:The late blight pathogen, Phytophthora infestans has a broad host range within the Solanaceae family, including yellow potato (Solanum phureja). The disease caused by P. infestans in S. phureja is poorly understood and is a major concern in Colombia. Expressed Sequence Tag (EST) libraries obtained from a normalized library constructed from healthy plant tissue revealed high levels of sequence similarity between S. phureja and S. tuberosum. Then, utilizing Serial Analysis of Gene Expression and high-throughput sequencing (SAGE-Solexa), we characterized yellow potato gene expression during infection by P. infestans. Four-week-old yellow potato plants were inoculated with P. infestans and were collected at 12 and 72 hours post inoculation for RNA extraction. We detected differentially expressed genes by comparing inoculated to non-inoculated and resistant to susceptible plants. The discovery and characterization of the proteins mediating this host–pathogen interaction enable the understanding of the pathosystem and is the key for developing resistant plants. Keywords: SAGE-Solexa, inoculation response, transcript profiling, Solanum phureja, Phytophthora infestans Four-week-old yellow potato (Solanum phureja) plants were inoculated with Phytophthora infestans and were collected and flash frozen in liquid nitrogen at 12 and 72 hours post inoculation, as well as mock inoculated, for RNA extraction. 2 yellow potato cultivars (resistant and susceptible) were used for each experiment. Mock inoculated plants were collected in each replicate. RNA obtained from each of the three biological replicates was pooled to obtain a single RNA sample for each timepoint X cultivar combination. A total of 6 different SAGE libraries were thus obtained. For all libraries, Illumina sequencing was performed at Canada´s Michael Smith Genome Sciences Centre.
2009-06-13 | E-GEOD-11781 | biostudies-arrayexpress
Project description:Xylem sap proteome studies on susceptible or resistant tomato (Solanum lycopersicum) inoculated with endophytic and/or pathogenic strains of Fusarium oxysporum f.sp. lycopersici were conducted to get insights into the molecular differences between endophyte- and R-gene-mediated resistance (EMR and RMR). The EMR and RMR proteomes were compared to each other and to the mock control. Interestingly, specific PR-5 isoforms were found to exclusively accumulate during endophyte or genetic resistance, providing excellent markers to distinguish both resistance types at the molecular level.
2019-11-14 | PXD011072 | Pride
Project description:The late blight pathogen, Phytophthora infestans has a broad host range within the Solanaceae family, including yellow potato (Solanum phureja). The disease caused by P. infestans in S. phureja is poorly understood and is a major concern in Colombia. Expressed Sequence Tag (EST) libraries obtained from a normalized library constructed from healthy plant tissue revealed high levels of sequence similarity between S. phureja and S. tuberosum. Then, utilizing Serial Analysis of Gene Expression and high-throughput sequencing (SAGE-Solexa), we characterized yellow potato gene expression during infection by P. infestans. Four-week-old yellow potato plants were inoculated with P. infestans and were collected at 12 and 72 hours post inoculation for RNA extraction. We detected differentially expressed genes by comparing inoculated to non-inoculated and resistant to susceptible plants. The discovery and characterization of the proteins mediating this host–pathogen interaction enable the understanding of the pathosystem and is the key for developing resistant plants. Keywords: SAGE-Solexa, inoculation response, transcript profiling, Solanum phureja, Phytophthora infestans
2009-06-13 | GSE11781 | GEO
Project description:Late blight, caused by the oomycete Phytophthora infestans, is one of the most damaging potato diseases. Genetic resistance is one of the most effective means to control the destruction caused by this pathogen. Transgenic potato lines harboring a resistance gene, RB, confer broad-spectrum, rate-reducing late blight resistance. A microarray approach was used to understand what genes are manipulated in the potato background after the addition of the RB gene that contribute to the late blight resistant phenotype. Keywords: Time course, disease state analysis CRD (3x2x2) Split-Split Plot: 3 sampling time points after inoculation (2, 5, 10 hours), Two genotypes (Katahdin with and without the RB gene), Inoculation with P. infestans or mock inoculation with water. 48 arrays were hybridized in total; 12 in each biological replicate. Each genotype with the mock and late blight inoculated samples was hybridized on two arrays using a dye-swap procedure. Each genotype had a total of 6 arrays across the three sampling time points.
2010-05-22 | E-GEOD-13341 | biostudies-arrayexpress
Project description:To effectively manage resources, regulatory cross-talk between biological processes within an organism is essential. An emerging area in plant research focuses on antagonism between regulatory systems controlling growth/development and those governing immunity. Such crosstalk represents a point of vulnerability for pathogens to exploit. Here we show that the notorious potato blight pathogen Phytophthora infestans promotes a growth and development pathway in order to antagonise plant immunity. AVR2, an effector protein secreted by P. infestans, has been shown to interact with potato BSL1, a putative phosphatase implicated in brassinosteroid hormone signalling. Plants expressing AVR2 exhibit transcriptional and phenotypic overlaps with an over-active brassinosteroid signalling pathway, and have compromised immunity. The activity of AVR2 leads to up-regulation of a functional orthologue of AtHBI1, known to facilitate cross-talk between the brassinosteroid pathway and immune signalling in Arabidopsis. Transient expression of potato HBI1-like compromises immunity and enhances leaf colonisation by P. infestans. Knowledge of how pathogens manipulate regulatory cross-talk governing resource allocation in plants will inform crop breeding efforts of the future; helping to maximise both yield and resistance to ensure food security as pressure on our agricultural systems increases.
2017-03-01 | E-MTAB-3854 | biostudies-arrayexpress
Project description:Phytophthora species are a destructive group of filamentous plant pathogens, which have a global distribution and devastating effect on a wide range of plants important to agriculture and natural ecosystems. Throughout the infection cycle, Phytophthora secrete an effector repertoire into its host to inhibit or counter defence associated compounds, lytic enzymes and intracellular processes required for immunity. Despite the advent of genome sequences of both host and microbe however, little is known about the signal interplay between host and pathogen during infection. Here we explore and report on the association between the hemi-biotrophic broad host range pathogen Phytophthora capsici and tomato. Infection assays reveal a distinct hemi-biotrophic infection cycle, featuring haustoria formation early in infection, followed by necrotrophy in the lateinfection stages. We assessed gene expression changes during infection in both P. capsici and tomato and unveil distinct changes in both host and pathogen transcriptomes, associated with biotrophy and the subsequent switch to necrotrophy. These results suggest dynamic but highly regulated transcriptional programmes that underpin P. capsici hemi-biotrophy. Our results provide new detail on coordinate transcriptional reprogramming during infection and sheds light on the basic processes that accompany hemibiotrophy. Please note the timepoint is hours post inoculation (hpi) of P capsici zoospores on detached tomato leaves. Where it is na (not applicable), these are in vitro cultures of P capsici only.
2013-03-24 | E-MTAB-1295 | biostudies-arrayexpress
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:Arbuscular mycorrhizal symbiosis is a predominant relationship between plant and arbuscular mycorrhizal fungi. To idendify arbuscular mycorrhiza responsive miRNAs, small RNA libraries were constructed in tomato roots colonized with Rhizophagus irregularis and without Rhizophagus irregularis. We identify miRNAs in tomato roots and provide a new profile of tomato miRNAs. And we found that some miRNAs were responsive to arbuscular mycorrhiza by comparing miRNAs in treatment with that in control. Examination of arbuscular mycorrhiza responsive miRNAs in tomato through high-throughput small RNA sequencing of roots with Rhizophagus irregularis and that without Rhizophagus irregularis
2016-07-20 | E-GEOD-76204 | biostudies-arrayexpress
Project description:Pseudomonas syringae pv. tomato DC3000 (Pst) is a virulent pathogen, which causes disease on tomato and Arabidopsis. The type III secretion system (TTSS) plays a key role in pathogenesis by translocating virulence effectors from the bacteria into the plant host cell, while the phytotoxin coronatine (COR) contributes to virulence and disease symptom development. Recent studies suggest that both the TTSS and and COR are involved in the suppression of host basal defenses. However, little is known about the interplay between the host gene expression associated with basal defenses and the virulence activities of the TTSS and COR during infection. The global effects of the TTSS and COR on host gene expression associated with other host cellular processes during bacterial infection are also not well characterized. In this study, we used the Affymetrix full genome chip to determine the Arabidopsis transcriptome associated with basal defense to Pst DC3000 hrp mutants and the human pathogenic bacterium Escherichia coli O157:H7. We then used Pst DC3000 virulence mutants to characterize Arabidopsis transcriptional responses to the action of hrp-regulated virulence factors (e.g., TTSS and COR) during bacterial infection. Additionally, we used bacterial fliC mutants to assess the role of the PAMP flagellin in induction of basal defense-associated transcriptional responses. In total, our global gene expression analysis identified more than 5000 Arabidopsis genes that are reproducibly regulated more than 2-fold in three independent biological replicates of at least one type of comparison. Regulation of these genes provides a molecular signature for Arabidopsis basal defense to plant and human pathogenic bacteria, and illustrates both common and distinct global virulence effects of the TTSS, COR, and possibly other hrp-regulated virulence factors during Pst DC3000 infection. Experimenter name = William Underwood; Experimenter phone = 517-353-9182; Experimenter fax = 517-353-9168; Experimenter address = Michigan State University; Experimenter address = 222 Plant Biology Building; Experimenter address = 178 Wilson R.d. Experimenter address = East Lansing, MI; Experimenter zip/postal_code = 48824; Experimenter country = USA Experiment Overall Design: 40 samples were used in this experiment
2008-06-13 | E-GEOD-5520 | biostudies-arrayexpress