Determination of the spatial organization of the FXN gene locus by using Chromosome Conformation Capture technique coupled with High-throughtput sequencing (3C-seq).
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: sanjay khadayate
PROVIDER: E-GEOD-42961 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We report the distribution of interactive sites with the sequence close from Meis2 promoter within the genome of mouse embryonic forebrain. We prepared the chromatin from 11 dpc embryonic forebrain and made 3C (chromosomal conformation capture) library. High-throughput sequencing applied for the 3C analysis revealed the distribution of modified interactive sites within developing forebrain. 4C-seq analysis of mouse 11 dpc embryonic forebrain with the sequence close from Meis2 promoter. Forebrain isolated and disected from 11 dpc embryos are fixed by 1% formaldehyde. After conventional 3C reaction, 3C library for highthroughput sequence is prepared by combination of adaptor ligation and nesting PCR reactions.
2014-01-15 | E-GEOD-52281 | biostudies-arrayexpress
Project description:Though important for gene regulation most studies of genome organisation use either fluorescence in situ hybridisation (FISH) or chromosome conformation capture (3C) methods. FISH directly visualises the spatial relationship of sequences, but is usually applied to a few loci at a time. The frequency at which sequences are ligated together by formaldehyde crosslinking can be measured genome-wide by 3C methods, with higher frequencies thought to reflect shorter distances. FISH and 3C should therefore give the same views of genome organisation, but this has not been tested extensively. We investigate the murine HoxD locus with 5C and FISH in different developmental and activity states, and in the presence or absence of epigenetic regulators. We identify situations where the two datasets are concordant, but find other conditions where chromatin topographies extrapolated from 5C or FISH data are not compatible. We conclude that products captured by 3C do not always reflect spatial proximity, with ligation occurring between sequences located hundreds of nanometers apart – influenced by nuclear environment and chromatin composition. We conclude that results obtained at high-resolution with either 3C methods or by FISH alone must be interpreted with caution and that conclusions about genome organisation should be validated by independent methods. 5C oligonucleotides were designed around EcoRI restriction sites following an alternative scheme
2015-01-02 | E-GEOD-61814 | biostudies-arrayexpress
Project description:Transcription factor SOX9 is essential for the differentiation of chondrocytes and the development of testes. Heterozygous point mutations and genomic deletions involving SOX9 lead to campomelic dysplasia (CD) often associated with sex reversal. Chromosomal rearrangements with breakpoints mapping up to 1.3 Mb up- and downstream to SOX9, and likely disrupting its distant cis-regulatory elements, have been described in patients with milder forms of CD. Performing chromosome conformation capture-on-chip (4C) analysis in Sertoli cells and lymphoblasts we identified several novel potentially cis-interacting regions both up- and downstream to SOX9, with some of them overlapping lncRNA genes preferentially expressed in testes. Custom designed 3x720K tiling microarrays covering 4 Mb region (chr17:68,117,161-72,122,560) flanking SOX9 gene of interest
2013-09-08 | E-GEOD-50449 | biostudies-arrayexpress
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:Capture-C was performed on sonicated and amplified 3C libraries generated from nuclei isolated from 2-3h whole embryo samples or Mef2-/Elav-sorted nuclei from 6-8h and 10-12h embryo samples. Capture-C was performed on wildtype embryos. Capture-C was performed using two different Capture probe pools, one for TSS and one for CRM. TSS and CRM were hand curated for tissue- and stage-specific activity.
2023-12-07 | E-MTAB-9310 | biostudies-arrayexpress
Project description:Capture-C was performed on sonicated and amplified 3C libraries generated from nuclei isolated from fixed 3-18h Drosophila whole embryo samples. Capture-C was performed on wildtype and embryos with deletions or insertions at loop anchors/genes at the respective loci (scyl-chrb or tsh-tio). Capture-C was performed using two different Capture probe pools, one indicated as left (scyl, tsh, salm) and one as right (chrb, tio, salr).
2023-12-07 | E-MTAB-13271 | biostudies-arrayexpress
Project description:Proteins co-purifying with recombinantly purified and N-terminally GFP-3C-tagged CTCF N-terminus (amino acids 1-293) produced in bacteria were identified by incubating the tagged bait with soluble nuclear protein extracts from 0-12h hour-old wildtype (OregonR strain) Drosophila melanogaster embryos.
2021-01-18 | PXD019487 | Pride
Project description:Using 4C-Seq experimental procedure we have characterized, in cultured chicken lymphoid and erythroid cells, genome-wide patterns of spatial contacts of several CpG islands scattered along the chromosome 14. A clear tendency for interaction of CpG islands present within the same and different chromosomes has been observed. Accordingly, preferential spatial contacts between Sp1 binding motifs, and other GC-rich genomic elements including DNA sequence motifs capable to form G-quadruplexes were demonstrated. On the other hand, an anchor placed in gene/CpG islands-poor area was found to form spatial contacts with other gene/CpG islands-poor areas within chromosome 14 and other chromosomes. These results corroborate the two compartments model of interphase chromosome spatial organization and suggest that clustering of CpG islands harboring promoters and origins of DNA replication constitutes an important determinant of the 3D organization of eukaryotic genome in the cell nucleus. Using ChIP-Seq experimental procedure we have mapped genome-wide the CTCF deposition sites in chicken lymphoid and erythroid cells subjected to the 4C analysis. A good correlation between the density of these sites and the level of 4C signals was observed for the anchors located in CpG islands. It is thus possible that CTCF contributes to the clustering of CpG islands revealed in our experiments. We applied 4C-seq to map long-range interactions of a CpG island harboring promoter of a housekeeping gene NPRL3 on a genome-wide scale in DT40 and HD3 cell lines in chicken (Gallus gallus). Two replicates per cell line were sequenced in paired-end mode with a depth of 45-64 million reads. We next performed additional 4C experiments on HD3 cells with different 4C anchors. In three experiments anchors were placed on different CpG island on the chromosome 14 that have demonstrated a strong interaction with the NPRL3 anchor (anchors near TSR3, TRAP1, PPL genes). In the forth experiment (anchor GENE-Des) the anchor was placed in a gene-poor area that did not interact with the NPRL3 promoter. The libraries for all anchors were pooled and sequenced in paired-end mode with a total depth of 75 million reads. Anchor NPRL3: two replicates for HD3 and two replicates for DT40 cell lines. Other anchors (TSR3, GENE-Des, TRAP1, PPL): two replicates, pooled library
2014-03-01 | E-GEOD-51937 | biostudies-arrayexpress
Project description:Although higher-order genome organization is tissue-specific, its functional relevance and mechanistic basis are poorly understood. Here we analyzed the dynamics of chromatin interactions for lineage-specific cytokine loci during T helper (Th) differentiation. The naive-to-effector transition is accompanied by a profound shift from promiscuous to highly selective and functionally enriched genome-wide contacts. Despite the establishment of divergent interactomes and global reprogramming of transcription in Th1 versus Th2 commitment, the overall expression status of the contact genes is surprisingly similar between the two lineages. Importantly, the genomic contacts are retained and strengthened precisely at DNA binding sites of the specific lineage-determining STAT transcription factor. The global aggregation of STAT binding loci from genic and non-genic regions highlights a new role for differentiation-promoting transcription factors in direct specification of higher-order nuclear architecture through interacting with regulatory regions. Such subnuclear environments have implications for efficient functioning of the mature effector lymphocytes. Nineteen arrays total: Eighteen microarrays from individual biological replicates, one microarray from a pool of two biological replicates.
2012-12-03 | E-GEOD-38717 | biostudies-arrayexpress
Project description:Copy number variants (CNVs) influence the expression of genes that map not only within the rearrangement, but also to its flanks. To assess the possible mechanism(s) underlying this “neighboring effect”, we compared intrachromosomal interactions and histone modifications in cell lines of patients affected by genomic disorders and control individuals. Using chromosome conformation capture (4C-seq), we observed that a set of genes flanking the Williams-Beuren Syndrome critical region (WBSCR) were often looping together, possibly forming an interacting cluster with each other and the WBSCR. Deletion of the WBSCR disrupts the expression of this group of flanking genes, as well as long-range interactions between them and the rearranged interval. We also pinpointed concomitant changes in histone modifications between samples.We conclude that large genomic rearrangements can lead to chromatin conformation changes that extend far away from the structural variant, thereby possibly modulating expression globally and modifying the phenotype. For example, we determined that the chromatin conformation, histone marks and relative expression levels of the flanking AUTS2 gene, mutations of which are associated with autism and intellectual disabilities, are modified in cell lines from Williams-Beuren syndrome patients. Examination of 4C-seq interaction profile of seven different genes (of which three in duplicate) in 2 different cell lines.
2013-11-20 | E-GEOD-33867 | biostudies-arrayexpress