RNA-Guided Human Gene Activation by Cas9/CRISPR-Based Engineered Transcription Factors
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Timothy Reddy
PROVIDER: E-GEOD-47114 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:The airways of the human lung are lined by an epithelium made up of ciliated and secretory luminal cells and undifferentiated p63+ Krt5+ basal cells. The integrity of this epithelium and its ability to act as a selective barrier are critical for normal lung function. In other epithelia there is evidence that transcription factors of the evolutionarily conserved grainyheadlike (GRHL) family play key roles in co-ordinating the expression of numerous proteins required for epithelial morphogenesis, differentiation, remodeling and repair. However, little is known about their function in the adult lung. Here, we focus on the role of GRHL2 in primary human bronchial epithelial (HBE) cells, using either shRNA or a dominant negative protein (DN-GRHL2) to inhibit its function. We follow changes in epithelial phenotype, and in gene transcription using RNA-seq or microarray analysis, both in undifferentiated basal cells and in cells differentiating in air-liquid interface culture into a mucociliary epithelium with transepithelial electrical resistance. We identify several hundreds of genes that are directly or indirectly regulated by GRHL2. Using ChIP-seq to map sites of GRHL2 binding in the basal cells we identify 7,687 potential primary targets, and confirm that GRHL2 binding is strongly enriched near GRHL-regulated genes. Different subsets of the large cohort of potential GRHL2 targets appear to be active in basal and differentiated cells. Taken together, the results strongly support the hypothesis that GRHL2 plays a key role in regulating many physiological functions of human airway epithelium, including those involving cell adhesion, polarity and morphogenesis. Frozen primary human bronchial epithelial (HBE) cells were obtained from three donors. Passage 2 cells at 40% confluence were infected with H2B-GFP or DN-GRHL2 lentivirus and 1 mg/ml puromycin added 48 h later. At confluence, Doxycycline 0.5 mg/ml was added for 24 h. RNA-seq was performed on all six samples, as well as samples from two donors that were not infected.
2013-05-07 | E-GEOD-44718 | biostudies-arrayexpress
Project description:Synthetic transcription factors can be applied in many areas of biotechnology, medicine, and basic research. In contrast to current methods based on engineering new DNA-binding proteins, we show that Cas9 fused to a transcriptional activation domain can be targeted by combinations of guide RNA molecules to induce the expression of endogenous human genes. This simple approach for targeted gene activation circumvents the need for engineering new proteins and will enable widespread synthetic gene regulation.
2013-07-25 | GSE47114 | GEO
Project description:Synthetic DNA-binding proteins have found broad application in gene therapies and as tools for interrogating biology. Engineered proteins based on the CRISPR/Cas9 and TALE systems have been used to alter genomic DNA sequences, control transcription of endogenous genes, and modify epigenetic states. Although the activity of these proteins at their intended genomic target sites have been assessed, the genome-wide effects of their action have not been extensively characterized. Additionally, the role of chromatin structure in determining the binding of CRISPR/Cas9 and TALE proteins to their target sites and the regulation of nearby genes is poorly understood. Characterization of the activity these proteins using modern high-throughput genomic methods would provide valuable insight into the specificity and off-target effects of CRISPR- and TALE-based genome engineering tools. We have analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators targeted to the promoters of two different endogenous human genes in HEK293T cells using a variety of high-throughput DNA sequencing methods. In particular, we assayed the DNA-binding specificity of these proteins and their effects on the epigenome. DNA-binding specificity was evaluated by ChIP-seq and RNA-seq was used to measure the specificity of these activators in perturbing the transcriptome. Additionally, DNase-seq was used to identify the chromatin state at target sites of the synthetic transcriptional activators and the genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these genome engineering technologies are highly specific in both binding to their promoter target sites and inducing expression of downstream genes when multiple activators bind to a single promoter. Moreover, we show that these synthetic activators are able to induce the expression of silent genes in heterochromatic regions of the genome by opening regions of closed chromatin and decreasing DNA methylation. Interestingly, the transcriptional activation domain was not necessary for DNA-binding or chromatin remodeling in these regions, but was critical to inducing gene expression. This study shows that these CRISPR- and TALE-based transcriptional activators are exceptionally specific. Although we detected limited binding of off-target sites in the genome and changes to genome structure, these off-target event did not lead to any detectable changes in gene regulation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. HEK293T cells were transfected in triplicate with plasmids expressing synthetic transcription factors. The synthetic TFs were either (a) dCas9-VP64 fusion protein and a targeting guide RNA (gRNA), or (b) a TALE-VP64 fusion protein engineered to bind to a specific target site in the genome. As a control, cells were transfected with plasmids expressing GFP. After transfection, RNA-seq was used to identify both on-target and off-target binding sites for the synthetic TFs. The data in this submission were generated using the TALE transfection experiments.
2015-05-27 | E-GEOD-68341 | biostudies-arrayexpress
Project description:Since LAMC2 is a secreted molecule present in the extracellular matrix of the cells, was designed a strategy based on CRISPR/Cas9-mediated homologous recombination to mark LAMC2 cells in human PDACs. A Cas9 single-guide RNAs complementary to sequences overlapping the stop codon of the LAMC2 locus was designed and a donor vector that contained LAMC2 homology arms flanking an EGFP reporter cassette positioned immediately upstream of the stop codon was generated. LF2A self-cleavage peptide in frame with EGFP so that LAMC2-EGFP locus was expressed as a single mRNA was added, whereas the resulting polypeptide was cleaved in the two encoded proteins, LAMC2 and EGFP. L3.6pl and PANC-1 cells were nucleofected with the donor vector together with a guide-RNA-Cas9 (guide). The engineered cells were subcutaneously injected in CD1 male mice and RNA-seq was performed on LAMC2-EGFP+ and EGFP- -derived tumors.
2022-04-11 | E-MTAB-11597 | biostudies-arrayexpress
Project description:The CRISPR (clustered regulatory interspaced short palindromic repeats)/ Cas9 (CRISPR-associated protein 9) system-based precise genome editing has revolutionized biomedical studies. As the CRISPR/Cas9 system has been also recently considered to permanently cure genetic diseases via human germline genome editing, a careful risk assessment of this genome engineering tool is required in human early development. Here we perform comprehensive analysis to evaluate the potential impact of Cas9 in human early embryogenesis. We find that even in the absence of synthetic guide RNA, Cas9 can be still guided by endogenous RNAs, and cut the genome of human embryonic cells at low frequency, and the resulting DNA damage induces the intrinsic immune response. Moreover, Cas9 interferes with the spliceosome, and with the suppressor machinery (e.g. L1TD1, APOBEC3G and PIWIL4) of LINE-1 (L1) retrotransposition. Even the transient presence of Cas9 in human embryonic cells induces robust de novo L1 retrotransposition that exacerbates DNA damage, and results in compromised neurodevelopment. Besides the ethical issues, these inevitable and detrimental Cas9-associated impacts on human embryonic development raise such serious safety concerns as to question the clinical use of human germline genome editing.
2022-12-31 | GSE161632 | GEO
Project description:The CRISPR (clustered regulatory interspaced short palindromic repeats)/ Cas9 (CRISPR-associated protein 9) system-based precise genome editing has revolutionized biomedical studies. As the CRISPR/Cas9 system has been also recently considered to permanently cure genetic diseases via human germline genome editing, a careful risk assessment of this genome engineering tool is required in human early development. Here we perform comprehensive analysis to evaluate the potential impact of Cas9 in human early embryogenesis. We find that even in the absence of synthetic guide RNA, Cas9 can be still guided by endogenous RNAs, and cut the genome of human embryonic cells at low frequency, and the resulting DNA damage induces the intrinsic immune response. Moreover, Cas9 interferes with the spliceosome, and with the suppressor machinery (e.g. L1TD1, APOBEC3G and PIWIL4) of LINE-1 (L1) retrotransposition. Even the transient presence of Cas9 in human embryonic cells induces robust de novo L1 retrotransposition that exacerbates DNA damage, and results in compromised neurodevelopment. Besides the ethical issues, these inevitable and detrimental Cas9-associated impacts on human embryonic development raise such serious safety concerns as to question the clinical use of human germline genome editing.
2022-12-31 | GSE161634 | GEO
Project description:The CRISPR (clustered regulatory interspaced short palindromic repeats)/ Cas9 (CRISPR-associated protein 9) system-based precise genome editing has revolutionized biomedical studies. As the CRISPR/Cas9 system has been also recently considered to permanently cure genetic diseases via human germline genome editing, a careful risk assessment of this genome engineering tool is required in human early development. Here we perform comprehensive analysis to evaluate the potential impact of Cas9 in human early embryogenesis. We find that even in the absence of synthetic guide RNA, Cas9 can be still guided by endogenous RNAs, and cut the genome of human embryonic cells at low frequency, and the resulting DNA damage induces the intrinsic immune response. Moreover, Cas9 interferes with the spliceosome, and with the suppressor machinery (e.g. L1TD1, APOBEC3G and PIWIL4) of LINE-1 (L1) retrotransposition. Even the transient presence of Cas9 in human embryonic cells induces robust de novo L1 retrotransposition that exacerbates DNA damage, and results in compromised neurodevelopment. Besides the ethical issues, these inevitable and detrimental Cas9-associated impacts on human embryonic development raise such serious safety concerns as to question the clinical use of human germline genome editing.
2022-12-31 | GSE161633 | GEO
Project description:Telomere erosion contributes to age-associated tissue dysfunction and senescence, and p53 plays a crucial role in this response. We undertook a genome-wide screen to identify gene deletions that sensitized p53-positive human cells to loss of telomere integrity, and uncovered a previously unannotated gene, C16ORF72, which we term Telomere Attrition and p53 Response 1: TAPR1. CRISPR-Cas9 mediated deletion of TAPR1 led to elevated p53 and induction of p53 transcriptional targets. TAPR1-disrupted cells exhibited a synthetic-sick relationship with the loss of telomerase, or treatment with the topoisomerase II inhibitor doxorubicin. Stabilization of p53 with nutlin-3a further decreased cell fitness in cells lacking TAPR1 or telomerase, whereas deletion of TP53 rescued the decreased fitness of TAPR1-deleted cells. We propose that TAPR1 regulates p53 turnover, thereby tapering the p53-dependent response to telomere erosion. We discuss the possible implications of such a mechanism in the preservation of genome integrity during senescence or aging.
2021-03-04 | PXD022128 | Pride
Project description:CRISPR-Cas9 expression independent of its cognate synthetic guide RNA (gRNA) causes widespread genomic DNA damage in human cells. To investigate whether Cas9 can interact with endogenous human RNA transcripts independent of its guide, we perform eCLIP (enhanced CLIP) of Cas9 in human cells and find that Cas9 reproducibly interacts with hundreds of endogenous human RNA transcripts. This association can be partially explained by a model built on gRNA secondary structure and sequence. Critically, transcriptome-wide Cas9 binding sites do not appear to correlate with published genome-wide Cas9 DNA binding or cut-site loci under gRNA co-expression. However, even under gRNA co-expression low-affinity Cas9-human RNA interactions (which we term CRISPR crosstalk) do correlate with published elevated transcriptome-wide RNA editing. Our findings do not support the hypothesis that human RNAs can broadly guide Cas9 to bind and cleave human genomic DNA, but they illustrate a clear cellular RNA impact likely inherent to CRISPR-Cas systems.
2022-01-24 | GSE167466 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress