Project description:Small noncoding RNA (sncRNA), including microRNAs (miRNAs) and endogenous small-interfering RNAs (endo-siRNAs) are key gene regulators in eukaryotes, playing critical roles in plant development and stress tolerance. Trans-acting siRNAs (ta-siRNAs), which are secondary siRNAs triggered by miRNAs, and siRNAs from natural antisense transcripts (nat-siRNAs) are two well-studied classes of endo-siRNAs. In order to understand sncRNAsM-bM-^@M-^Y roles in plant cold response and stress acclimation, we studied miRNAs and endo-siRNAs in Cassava (Manihot esculenta), a major source of food for the world populations in tropical regions. Combining Next-Generation sequencing and computational and experimental analyses, we profiled and characterized sncRNA species and mRNA genes from the plants that experienced severe and moderate cold stresses, that underwent further severe cold stress after cold acclimation at moderate stress, and that grew under the normal condition. We also included Castor bean (Ricinus communis) to understand conservation of sncRNAs. In addition to known miRNAs, we identified dozens of novel miRNAs as well as ta-siRNA-yielding and nat-siRNA-yielding loci in Cassava and Castor bean, respectively. Among the expressed sncRNAs, many sncRNAs were differentially expressed under cold stresses. Our study provided the results on gene regulation by sncRNAs in cold acclimation of Euphorbiaceous plants and the role of sncRNA-mediated pathways affected by cold stress and stress acclimation in Cassava. Examination of small RNA populations in Cassava cultivar SC124 under the normal condition (NC), gradual cold acclimation (CA), cold shock (CS) and stress acclimation Cold stress after cold acclimation (CCA).
Project description:Stress acclimation is an effective mechanism that plants acquired for adaption to dynamic environmental conditions. After undergoing cold acclimation, plants become more tolerant to cold stress. In order to understand the mechanism of cold acclimation, we performed a systematic, comprehensive study of cold response and acclimation in Cassava (Manihot esculenta), a staple crop and major food source in the tropical regions of the world. We profiled mRNA genes and small-RNA species, using next generation sequencing, and performed an integrative analysis of the transcriptome and microRNAome of Cassava across the normal condition, a moderate cold stress at 14M-BM-0C, a harsh stress at 4M-BM-0C after cold acclimation at 14M-BM-0C, and a cold shock from 24M-BM-0C to 4M-BM-0C. Two results from the analysis were striking. First, the moderate stress and cold shock, despite a difference of 10M-BM-0C between the two, triggered comparable degrees of perturbation to the transcriptome; in contrary, further harsh stress after cold acclimation resulted in a much smaller degree of transcriptome variation. Second and more importantly, about two thirds of the up- or down-regulated genes after moderate stress reversed their expression to down- or up-regulation, respectively, under harsh stress after cold acclimation, resulting in a genome-wide rewiring of regulatory networks. MicroRNAs, which are key post-transcriptional gene regulators, were major players in this massive rewiring of genetic circuitry. Further, a function enrichment analysis of the perturbed genes revealed that cold acclimation helped the plant to develop immunity to further harsh stress by exclusively inducing genes with functions of nutrient reservoir; in contrast, many genes with functions of viral reproduction were induced by cold shock. Our study revealed, for the first time, the molecular basis of stress acclimation in plants, and shed lights on the role of microRNA gene regulation in cold response and acclimation in Euphorbia. Three organs/tissues (folded leaf, fully expanded leaf and roots) of Cassava cultivar SC124 harvested at 6h, 24h and 5d for three cold treatments of CA, CCA and CS, for gene expression profiling at the stages of initial response, secondary response, and functional adaption to cold stresses. Total RNA of each sample was isolated individually, and then pooled with an equal amount from each sample into one for profiling. As a result, four mRNA libraries and four small-RNA libraries, corresponding to the conditions of CA, CCA, CS and NC, were constructed.
Project description:We first report the use of next-generation massively parallel sequencing technologies and de novo transcriptome assembly to gain insight into the wide range of transcriptome of Hevea brasiliensis. The output of sequenced data showed that more than 12 million sequence reads with average length of 90nt were generated. Totally 48,768 unigenes (mean size = 488 bp) were assembled through transcriptome de novo assembly, which represent more than 3-fold of all the sequences of Hevea brasiliensis deposited in the GenBank. Assembled sequences were annotated with gene descriptions, gene ontology and clusters of orthologous group terms. Total 37,373 unigenes were successfully annotated and more than 10% of unigenes were aligned to known proteins of Euphorbiaceae. The unigenes contain nearly complete collection of known rubber-synthesis-related genes. Our data provides the most comprehensive sequence resource available for study rubber tree and demonstrates the availability of Illumina sequencing and de novo transcriptome assembly in a species lacking genome information. The transcriptome of latex and leaf in Hevea brasiliensis
Project description:Background: Cassava is an important tropical root crop adapted to a wide range of environmental stimuli such as drought and acid soils. Nevertheless, it is an extremely cold-sensitive tropical species. Thus far, there is limited information about gene regulation and signaling pathways related to the cold stress response in cassava. The development of microarray technology has accelerated the study of global transcription profiling under certain conditions. Results: A 60-mer oligonucleotide 4X44K Agilent microarray representing 20,840 genes was used to perform transcriptome profiling in cassava apical shoots subjected to cold at 7M-BM-0C for 0 h, 4 h, and 9 h. A total of 508 transcripts were identified as early cold-responsive genes in which 319 sequences had descriptions when they were aligned with Arabidopsis proteins. Gene ontology (GO) annotation analysis identified many interesting categories including M-bM-^@M-^XResponse to abiotic and biotic stimulusM-bM-^@M-^Y, M-bM-^@M-^XResponse to stressM-bM-^@M-^Y, M-bM-^@M-^XTranscription factor activityM-bM-^@M-^Y, and M-bM-^@M-^XChloroplastM-bM-^@M-^Y. Various stress-associated genes comprising signal transduction components (e.g., MAP kinase 4), transcription factors (TFs; e.g., RAP2.11), and ROS scavenging enzymes (e.g., catalase 2), as well as photosynthesis-related genes (e.g., PSAL), were found. Seventeen major TF families were also identified as being involved in the early response to cold stress (e.g., AP2-EREBP). Meanwhile, KEGG pathway analysis uncovered many important pathways, including M-bM-^@M-^XPlant hormone signal transductionM-bM-^@M-^Y, M-bM-^@M-^XStarch and sucrose metabolismM-bM-^@M-^Y, and M-bM-^@M-^XPlant-pathogen interactionM-bM-^@M-^Y. Furthermore, the expression changes of 18 genes under cold and other abiotic stresses conditions were validated by real-time RT-PCR. As a response to cold stress in cassava, an increase in the ROS scavenging enzyme activities of catalase and superoxide dismutases and the accumulation of total soluble sugars were also detected. Importantly, most of the tested stress-responsive genes were primarily expressed in mature leaves, stem cambia, and fibrous roots rather than apical buds and young leaves. Conclusions: The dynamic expression changes reflect the integrative controlling and transcriptome regulation of the networks in the early cold stress response of cassava. The biological processes involved in the signal perception and physiological response might shed light on the molecular mechanisms related to cold tolerance in tropical plants and provide useful candidate genes for genetic improvement. Apical shoots subjected to cold at 7M-BM-0C for 0 h, 4 h, and 9 h were collected for RNA extractions from three independent healthy 3-month-old cassava (cultivar TMS60444) plants in the greenhouse.
Project description:We have applied whole transcriptome profiling to infer genetic determinants of pathogenicity and host specialization in Z. tritici. Our data includes RNAseq data from early infection stages of a compatible (wheat) and a non-compatible host (Brachypodium distachyon). Overall transcription of AC genes is remarkably lower than genes on core chromosomes (CC) and only 40% of the genes are transcribed. We identify 31 AC and 1069 CC genes showing plant specific expression. In addition 21 CC genes are only upregulated in wheat supporting functional relevance in host specificity. We further explore the genomic composition and distribution of unique and paralogous genes in Z. tritici focusing on the evolutionary origin of AC genes. In contrast to previous studies we show that ACs mainly encode unique genes. Phylogenetic analyses suggest that rare duplication events in the Z. tritici genome precede diversification of Zymoseptoria species and demonstrate that ACs have been maintained in the genome of Zymoseptoria over long evolutionary times. Examination of gene expression at 3 different growth condition of the wheat pathogen Z. tritici.
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
Project description:Recurrence of focal segmental glomerulosclerosis (rFSGS) after kidney transplantation is a cause of early and accelerated graft loss. Immuneadsorption can alleviate renal dysfunction and suggests that circulating antibodies (Ab) are likely implicated in disease pathogenesis. To evaluate pathogenic Ab in rFSGS, we processed 141 unique serum samples from patients with and without primary rFSGS (n=64) and 34 non-FSGS control, transplanted at five (US and EU) hospitals. 9000 antigens were screened in pre-transplant sera by protein arrays and 10 Ab targeting glomerular antigens were selected for ELISA validation. A panel of 7 Ab (CD40, PTPRO, CGB-5, FAS, P2RY11, SNRPB2 and APOL2) could predict post-transplant FSGS recurrence with 92% accuracy. Pre-transplant elevation of anti-CD40 Ab levels alone had a substantial impact (78% accuracy) on the identification of rFSGS risk after transplantation. Epitope mapping of CD40 with customized peptide arrays and rFSGS sera demonstrated altered immunogenicity of the extracellular CD40 domain in rFSGS. Immunohistochemistry of CD40 demonstrated a differential expression of these antigens in FSGS compared to non-FSGS. Anti-CD40 Ab purified from rFSGS patients were uniquely pathogenic in human podocyte cultures; injection of these Ab resulted in heightened proteinuria, independently and in combination with suPAR in a rodent model, abrogated by injection of monoclonal Ab to CD40. In conclusion, a panel of 7 Ab can identify primary FSGS patients at high risk of recurrence prior to transplantation, allowing for customized therapies and improved patient selection for transplant. Intra-renal CD40 is an important axis of disease pathogenesis, and human trials of anti-CD40 therapies are warranted to evaluate their efficacy in preventing rFSGS and improving graft survival. The purpose of the study was to identify potential auto-Abs associated with rFSGS. We used a discovery set of pre-transplant sera from 20 unique patients with biopsy confirmed diagnosis of primary FSGS as their cause of ESRD, of which 10 had progressed to rFSGS within the first post-transplant year and 10 did not have recurrence of proteinuria or histological disease after transplantation (nrFSGS).
Project description:Wounding due to mechanical injury or insect feeding causes a wide array of damage to the cell including cell disruption, desiccation, metabolite oxidation, and disruption of primary metabolism. In response, plants regulate a variety of genes and metabolic pathways to cope with injury. Tomato (Solanum lycopersicum) is a model for wound signaling but few studies have examined the comprehensive gene expression profiles in response to injury. A cross-species microarray approach using the TIGR potato 10-K cDNA array was analyzed for large-scale temporal (early and late) and spatial (locally and systemically) responses to mechanical wounding in tomato leaves. These analyses demonstrated that tomato regulates many primary and secondary metabolic pathways and this regulation is dependent on both timing and location. To determine if LAP-A, a known modulator of wound signaling, influences gene expression beyond the core of late wound-response genes, changes in RNAs from healthy and wounded Leucine aminopeptidase A-silenced (LapA-SI) and wild-type (WT) leaves were examined. While most of the changes in gene expression after wounding in LapA-SI leaves were similar to WT, overall responses were delayed in the LapA-SI leaves. Moreover, two pathogenesis-related 1 (PR-1c and PR-1a2) and two dehydrin (TAS14 and Dhn3) genes were negatively regulated by LAP-A. Collectively, this study has shown that tomato wound responses are complex and that LAP-A's role in modulation of wound responses extends beyond the well-described late-wound gene core. A reference design hybridization strategy was used with WT (0-hr) being the reference RNA. The reference RNA was a pool from five WT 0-hr RNAs. RNAs from wounded or unwounded leaves labeled with Cy3 and the reference RNA labeled with Cy5 were co-hybridized to the potato cDNA array. Three dye bias experiments were performed in which WT 0-hr RNAs were labeled with Cy3 and co-hybridized with the Cy5-labeled reference RNA (WT 0-hr RNAs from a different pool). After normalization, no dye bias was detected on these experiments (p-value<0.05).
Project description:Mechanisms related to the development of cassava storage roots and starch accumulation remain largely unknown. To evaluate genome-wide expression patterns during cassava tuberization, a 60-mer oligonucleotide microarray representing 20,840 cassava genes was designed to identify differentially expressed transcripts in fibrous root, developing storage root and mature storage root. Using a random variance model and the traditional two-fold change method for statistical analysis, 912 and 3386 differentially expressed genes were identified related to the three different phases. Among 25 significant pathways identified, glycolysis/gluconeogenesis was the most important pathway signature due to its effects on other pathways. Rate-limiting enzymes were identified from each individual pathway, such as pectinesterase, enolase, L-lactate dehydrogenase and aldehyde dehydrogenase in glycolysis/gluconeogenesis, and ADP-glucose pyrophosphorylase, starch branching enzyme and glucan phosphorylase in sucrose and starch metabolism. This study revealed that dynamic changes in at least 16% of the transcriptome, including hundreds of transcription factors, oxidoreductases/transferases/hydrolases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this biological process. The reliability of differentially expressed genes in microarray analysis was further verified by quantitative real-time RT-PCR. The genome-wide transcription analysis facilitates our understanding of the formation of the storage root and deciphers key genes for further cassava improvement. Fibrous roots (FR), developing storage roots (DR) and mature storage roots (MR) were collected for RNA extractions from three independent healthy 4 month-old cassava (cultivar TMS60444) plants in the field .Two RNA samples extracted from stored storage root slices were used as technical repeats (TR) for quality control.
Project description:Global warming may cause overwintering plants to lose tolerance to low temperatures owing to deacclimation caused by winter temperature fluctuations. This dataset presents the results of a research which aimed to find out how mutation in the HvBRI1 and HvCPD genes affects the signalling and synthesis of brassinosteroids, and in consequence, influences de-acclimation tolerance of barley. We verified a hypothesis that temperature-dependent changes in the expression of selected genes contribute to de-acclimation tolerance. This study was aimed to identify the mechanisms responsible for differences between mutants and their reference cultivar – Bowman. We investigated barley de-acclimation tolerance using two mutant lines: BW084, harboring a mutation in the HvCPD gene, and BW312, harboring a mutation in the HvBRI1 gene.