Differential effects of maternal high protein diets on liver transcriptomes
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
SUBMITTER: Jens Vanselow
PROVIDER: E-GEOD-56162 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Background The implication of post-transcriptional regulation by microRNAs in molecular mechanisms underlying cancer disease is well documented. However, their interference at the cellular level is not fully explored. Functional in vitro studies are fundamental for the comprehension of their role; nevertheless results are highly dependable on the adopted cellular model. Next generation small RNA transcriptomic sequencing data of a tumor cell line and keratinocytes derived from primary culture was generated in order to characterize the microRNA content of these systems, thus helping in their understanding. Both constitute cell models for functional studies of microRNAs in head and neck squamous cell carcinoma (HNSCC), a smoking-related cancer. Known microRNAs were quantified and analyzed in the context of gene regulation. New microRNAs were investigated using similarity and structural search, ab initio classification, and prediction of the location of mature microRNAs within would-be precursor sequences. Results were compared with small RNA transcriptomic sequences from HNSCC samples in order to access the applicability of these cell models for cancer phenotype comprehension and for novel molecule discovery. Results Ten miRNAs represented over 70% of the mature molecules present in each of the cell types. The most expressed molecules were miR-21, miR-24 and miR-205, Accordingly; miR-21 and miR-205 have been previously shown to play a role in epithelial cell biology. Although miR-21 has been implicated in cancer development, and evaluated as a biomarker in HNSCC progression, no significant expression differences were seen between cell types. We demonstrate that differentially expressed mature miRNAs target cell cycle progression and apoptosis related biological processes, indicating that they might represent, with acceptable accuracy, the genetic context from which they derive. Most miRNAs identified in the cancer cell line and in keratinocytes were present in tumor samples and cancer-free samples, respectively, with miR-21, miR-24 and miR-205 still among the most prevalent molecules at all instances. Thirteen miRNA-like structures, containing reads identified by the deep sequencing, were predicted from putative miRNA precursor sequences. Strong evidences suggest that one of them could be a new miRNA. This molecule was mostly expressed in the tumor cell line and HNSCC samples indicating a possible biological function in cancer. Conclusions Critical biological features of cells must be fully understood before they can be chosen as models for functional studies. Expression levels of miRNAs relate to cell type and tissue context. This study provides insights on miRNA content of two cell models used for cancer research. Pathways commonly deregulated in HNSCC were targeted by most expressed and also by differentially expressed miRNAs. Results indicate that the use of cell models for cancer research demands careful assessment of underlying molecular characteristics for proper data interpretation. Additionally, one new miRNA-like molecule with a potential role in cancer was identified in the cell lines and clinical samples. This submission represents the gene expression component of the study only Microarray analysis was performed using Agilent Whole Human Genome Microarray 4M-CM-^W44K arrays and labeled using the One Color Quick Amp Labeling Kit (Agilent Technologies). A total of four samples were analyzed: two biological replicates of SCC25 and two biological replicates of normal keratinocytes. Hybridization and washing followed protocols described by the manufacturer (Agilent Technologies). The one-color arrays were scanned by GenePix 4000B Scanner (Axon), and analyzed using the Agilent Feature extraction software (version 9.5). The quality control of the microarrays was assessed using the standard Agilent controls to verify that the arrays met the expected criteria.
2013-12-30 | E-GEOD-41436 | biostudies-arrayexpress
Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.
2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress
Project description:Analysis of the transcriptional profiles of mRNA and microRNA in Rasless fibroblasts. 4-Hydroxy-tamoxifen (4-OHT) treatment triggers removal of K-Ras expression in [H-Ras-/-;N-Ras-/-;K-Raslox/lox;RERTert/ert] mouse fibroblasts (named K-Raslox) generating M-bM-^@M-^\RaslessM-bM-^@M-^] MEFs which are unable to proliferate, but recover proliferative ability after ectopic expression of constitutively active downstream kinases such as BRAF and MEK1. Using Affymetrix microarrays, we compared the transcriptional profiles of Rasless fibroblasts to those of K-Raslox (MEFs lacking only H-Ras and N-Ras). We also compared the transcriptional profile of Rasless cells with those of BRAF and MEK1-transfected Rasless cells which recovered proliferative ability. Re-entry of the Rasless cells into cell cycle progression through ectopic expression of activated BRAF or MEK1 resulted in full reversion of most transcriptional alterations identified in cells lacking the three canonical Ras proteins. Pre-confluent cell cultures corresponding to the different Ras genotypes were harvested for extraction of total RNA and miRNA samples, and subsequent hybridization on Affymetrix microarrays. The different sets of experimental mRNA samples analyzed here included (i) 8 samples K-Raslox (proliferating cells expressing only K-Ras, considered as Control): 4 biological replicates, technical duplicates each; (ii) 7 samples Rasless: the same cells after treatment with 4-OHT for 12 days (to become non-proliferating fibroblasts), including 4 biological replicates and technical duplicates from 3 of them; (iii) 3 samples BRAF-rescued MEFs (Rasless cells harboring activated BRAF constructs, with regained proliferative ability): 3 biological replicates; (iv) 3 samples MEK1-rescued MEFs (Rasless cells harboring activated MEK1 constructs, with regained proliferative ability): 3 biological replicates; and their respective controls harbouring the vempty vectors (v) 2 samples Hygromycin-resistant (control for BRAF-transfected Rasless cells) including 2 biological replicates, and (vi) 4 samples Puromycin-resistant (control for MEK1-transfected Rasless cells) including 2 biological replicates, technical duplicates each. The gene expression study contains a total of 27 samples. Regarding the miRNA expression study, the experimental samples analyzed included (i) 4 samples samples K-Raslox (used as Control): 2 biological replicates, technical duplicates each; (ii) 8 samples Rasless: the same cells after treatment with 4-OHT for 6 days (2 biological replicates, technical duplicates each) and 12 days (2 biological replicates, technical duplicates each); (iii) 4 samples BRAF-rescued, including 2 biological replicates, technical duplicates each; (iv) 4 samples MEK1-rescued,including 2 biological replicates, technical duplicates each, and (v) 4 samples Puromycin-resistant empty vector, containing 2 biological replicates, technical duplicates each. The miRNA expression study contains a total of 24 samples.
2013-11-27 | E-GEOD-45222 | biostudies-arrayexpress
Project description:Transcriptonal profiling of BEAS-2B cells: Control versus skin sensitizers; Control versus respiratory sensitizers; Control versus non-sensitizing irritants Replicates: 3 biological replicates; Exposure: 10 different chemicals versus solvent, 1 exposure concentration (IC20); Exposure time: 3 different exposure time points;
2013-12-01 | E-GEOD-44729 | biostudies-arrayexpress
Project description:Under conditions of hormonal adjuvant treatment the estrogen receptor apoprotein supports breast cancer cell cycling through the retinoic acid receptor M-NM-11 apoprotein. Basal proliferation persisted in estrogen-sensitive breast cancer cells grown in hormone depleted conditioned media without or with 4-hydroxytamoxifen (OH-Tam). Downregulating ER using siRNA inhibited basal proliferation by promoting cell cycle arrest. The basal expression of RARM-NM-11, the only RARM-NM-1 isoform that was expressed in breast cancer cell lines and in most breast tumors, was supported by apo-ER but was unaffected by OH-Tam. The overlapping tamoxifen-insensitive gene regulation by apo-ER and apo-RARM-NM-11 comprised activation of mainly genes promoting cell cycle and mitosis and suppression of genes involved in growth inhibition. Cells were plated at 20% confluence in low glucose phenol red free medium supplemented with 5% charcoal stripped FBS and glutamine 24h-48h prior to transfection. Treatment with vehicle, OH-Tam (100nM), or OH-Tam (500nM) was begun an additional 24h later. Cells were transfected with control siRNA, ERM-NM-1 siRNA or RARM-NM-1 siRNA.
2011-05-13 | E-GEOD-26298 | biostudies-arrayexpress
Project description:The objective of the present study was to identify genes that are involved in increasing the ovulation number in mouse line FL1 that had been selected for high fertility performance. Experiment Overall Design: Ovaries from 30 animals of line FL1 and of the control line DUKsi were collected at the metestrous stage, combined to 6 pools each, and processed for microarray analysis.
2008-10-25 | E-GEOD-11113 | biostudies-arrayexpress
Project description:Mantle cell lymphoma (MCL) is an aggressive B-cell non-HodgkinM-bM-^@M-^Ys lymphoma (NHL). In cancers, tumour suppressive microRNAs may be silenced by DNA hypermethylation. By microRNA profiling, miR-155-3p was significantly upregulated upon demethylation treatment of MCL cell lines with 5-aza-2M-bM-^@M-^Y-deoxycytidine (5-azadC). Methylation-specific PCR, verified by pyrosequencing, showed complete methylation of miR-155-3p in one MCL cell line (REC-1). 5-azadC treatment of REC-1 led to demethylation and re-expression of miR-155-3p. Over-expression of miR-155-3p led to increased sub-G1 apoptotic cells and reduced cellular viability, demonstrating its tumour suppressive properties. By luciferase assay, lymphotoxin-beta (LT-M-NM-2) was validated as a miR-155-3p target. In 31 primary MCL, miR-155-3p was found hypermethylated in 6(19%) cases. To test if methylation of miR-155-3p was MCL-specific, miR-155-3p methylation was tested in an additional 191 B-cell, T-cell and NK-cell NHLs, yielding miR-155-3p methylation in 66(34.6%) including 36(27%) non-MCL B-cell, 24(53%) T-cell and 6(46%) of NK-cell lymphoma. Moreover, in 72 primary NHL samples with RNA, miR-155-3p methylation correlated with miR-155-3p downregulation (p=0.030), and LT-M-NM-2 upregulation (p=0.004). Collectively, miR-155-3p is tumour suppressive microRNA hypermethylated in MCL and other NHL subtypes. As miR-155-3p targets LT-M-NM-2, which is an upstream activator of the non-canonical NF-kB signalling, miR-155-3p methylation is potentially important in lymphomagenesis Total RNA isolated from MINO and JEKO-1 before and after 5-azadC treatment were converted into cDNA by MegaplexTM RT Primers and TaqManM-BM-. MicroRNA Reverse Transcription Kit. cDNA was pre-amplified using MegaplexTM PreAmp Primer and loaded onto 384-well format TaqmanM-BM-. human microRNA array A V2.0 & B V3.0. Real-time PCR was performed on 7900HT Real-Time PCR system and raw data were analyzed normalizing to mean of three endogenous controls (U6snRNA, RNU44 and RNU48). Relative microRNA levels were determined by M-NM-^TM-NM-^TCt using endogenous controls and untreated controls using SDS 2.4 and RQ manager 1.2. All experimental procedures and analyses were performed according to manufacturerM-bM-^@M-^Ys instruction, using reagents, system and softwares acquired from Applied Biosystems (Foster City, USA).
2014-08-31 | E-GEOD-57128 | biostudies-arrayexpress
Project description:Transcriptional profiling of a unicelluar diazotrophic cyanobacterium Cyanothece sp. ATCC 51142 in constant light under nitrogen fixing condition. The controls comprised of equimolar pool of RNA from all time points. Cyanothece sp. ATCC 51142 was grown in BG-11 medium without nitrate. The culture was entrained under 12 h alternate light/dark cycles for 96 h and released in constant light (LL). Nine samples were for two consecutive cycles under LL, at times when the culture underwent transitions in its photosynthetic and respiratory phases, as indicated by the exit CO2 and O2 profiles. Two biological replicates, two technical replicates and a dye swap were analyzed for each sample from individual time points.
2015-02-03 | E-GEOD-65429 | biostudies-arrayexpress
Project description:Genomic imprinting describes the expression of a subset of mammalian genes from one parental chromosome. The parent-of-origin specific expression of imprinted genes relies on DNA methylation of CpG-dinucleotides at differentially methylated regions (DMRs) during gametogenesis. We identified the paternally methylated DMRs at mouse chromosome 1 near the imprinted Zdbf2 gene using a methylated-DNA immunoprecipitation-on-chip (meDIP-on-chip) method applied to DNA from parthenogenetic (PG)- and androgenetic (AG)-derived cells and sperm. To identify novel DMRs, genome-wide methylation analysis of three samples were performed using MeDIP and whole genome tiling array.
2010-05-04 | E-GEOD-18126 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE18126: Methylation status in AG- and PG-derived cells and sperm GSE18178: Methylation status in human sperm Refer to individual Series
2010-05-04 | E-GEOD-21662 | biostudies-arrayexpress