Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cell cycle regulatory mechanisms in skeletal muscle cells

ABSTRACT: Genome wide gene expression analysis in G9a knockdown myoblasts Illumina WG-6 v2.0 arrays were hybridized with RNA from scrambled control and siG9a myoblasts to determine the gene expression profile murine skeletal myoblasts. All hybridizations were done in biological duplicates

ORGANISM(S): Mus musculus

SUBMITTER: Vinay Rao

PROVIDER: E-GEOD-70039 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

G9a promotes proliferation and inhibits cell cycle exit during myogenic differentiation.

Rao Vinay Kumar VK Ow Jin Rong JR Shankar Shilpa Rani SR Bharathy Narendra N Manikandan Jayapal J Wang Yaju Y Taneja Reshma R

Nucleic acids research 20160526 17

Differentiation of skeletal muscle cells, like most other cell types, requires a permanent exit from the cell cycle. The epigenetic programming underlying these distinct cellular states is not fully understood. In this study, we provide evidence that the lysine methyltransferase G9a functions as a central axis to regulate proliferation and differentiation of skeletal muscle cells. Transcriptome analysis of G9a knockdown cells revealed deregulation of many cell cycle regulatory genes. We demonstr ...[more]

PMID: 27229136

Similar Datasets

Cell cycle regulatory mechanisms in skeletal muscle cells

Project description:Genome wide gene expression analysis in G9a knockdown myoblasts

2016-07-21 | GSE70039 | GEO

Transcriptome-wide changes in HeLa cell line investigated in response to Heat-shock stress

Project description:The repertoire of transcripts that are differentially regulated in response to Heat-shock were studied using Illumina WG-6 v2.0 BeadChip.

2011-11-09 | GSE26776 | GEO

Global gene expression in E15.5 Gtf2ird1-/- mouse emybro heads

Project description:A compairson of gene expression in the heads of E15.5 Gtf2ird1-/- and wildtype mouse embryos using the the Illumina Mouse WG-6 v2.0 Expression BeadChip

2011-12-31 | E-MTAB-626 | biostudies-arrayexpress

G9a selectively represses a class of late-replicating genes at the nuclear periphery (WG_CGH)

Project description:We have investigated the role of the histone methyltransferase G9a in the establishment of silent nuclear compartments. Following conditional knockout of the G9a methyltransferase in mouse ESCs, 167 genes were significantly up-regulated, and no genes were strongly down-regulated. A partially overlapping set of 119 genes were up-regulated after differentiation of G9a-depleted cells to neural precursors. Promoters of these G9a-repressed genes were AT rich and H3K9me2 enriched but H3K4me3 depleted and were not highly DNA methylated. Representative genes were found to be close to the nuclear periphery, which was significantly enriched for G9a-dependent H3K9me2. Strikingly, although 73% of total genes were early replicating, more than 71% of G9a-repressed genes were late replicating, and a strong correlation was found between H3K9me2 and late replication. However, G9a loss did not significantly affect subnuclear position or replication timing of any non-pericentric regions of the genome, nor did it affect programmed changes in replication timing that accompany differentiation. We conclude that G9a is a gatekeeper for a specific set of genes localized within the late replicating nuclear periphery. 4 cell states each in duplicate (i.e. a total of 8 individual replicates)

2009-11-02 | E-GEOD-18079 | biostudies-arrayexpress

Unexpected distinct roles of the related histone H3 lysine 9 methyltransferases G9a and G9a-Like Protein in myoblasts

Project description:Lysine methyltransferases G9a and GLP (G9a- Like Protein) form functional heterodimeric complexes that establish mono- and dimethylation on histone H3 lysine 9 (H3K9me1, H3K9me2) in euchromatin. Here we describe unexpected opposite individual roles for G9a and GLP during skeletal muscle terminal differentiation. Indeed, gain- or loss-of-function assays in myoblasts showed that in consistency with previous reports that G9a inhibits terminal differentiation. But GLP plays a more complicated role in muscle differentiation since both knockdown and overexpression inhibits terminal differentiation. Unexpectedly, in contrast to G9a, we show that GLP overexpression promotes abnormal expression of muscle differentiationspecific genes in proliferating myoblasts. Transcriptomic analysis indicates that G9a and GLP regulate different sets of genes. GLP, but not G9a, inhibits at the transcriptional level proteasome subunit-encoding genes resulting in an inhibition of the proteasome activities. Subsequently, GLP, but not G9a, overexpression stabilizes MyoD that is likely to be responsible for muscle markers expression in proliferating myoblasts.

2016-02-01 | GSE72626 | GEO

Rodent malaria parasite RNA does not affect mouse BeadChip results

Project description:Rodent malaria parasite RNA hybridized on Illumina Mouse WG-6 v2.0 Expression BeadChip To investigate whether parasite RNA interfere with mouse beadchip analaysis. Malaria parasite resides in red blood cell, therefore RNA isolated from whole infected blood contains host RNA as well as parasite RNA

2020-04-30 | GSE145634 | GEO

Transcriptome-wide changes in HeLa cell line investigated in response to Heat-shock stress

Project description:The repertoire of transcripts that are differentially regulated in response to Heat-shock were studied using Illumina WG-6 v2.0 BeadChip. Study was undertaken with 3 biological replicates for each condition of Heat-Shock Treated and Untreated condition.

2011-11-09 | E-GEOD-26776 | biostudies-arrayexpress

G9a selectively represses a class of late-replicating genes at the nuclear periphery

Project description:This SuperSeries is composed of the following subset Series: GSE18076: G9a selectively represses a class of late-replicating genes at the nuclear periphery (Expression) GSE18079: G9a selectively represses a class of late-replicating genes at the nuclear periphery (WG_CGH) Refer to individual Series

2009-11-02 | E-GEOD-18082 | biostudies-arrayexpress

Gene expression for transformed YAMC clones

Project description:YAMC murine colonic epithelial cells were repeatitively treated with commensal bacteria-polarized macrophages or 4-HNE. Following 10 treatments, 25 clones were selected to engraft immunodeficient mice, and 10 out of 25 clones grew tumors in these mice. To explore gene expression associated with cellular transformation, whole-genome profiling was performed on 10 transformed clones and compared with untreated YAMC controls using Illumina Mouse WG-6 v2.0 Expression BeadChip. Total RNA obtained from 10 transformed clones and compared to untreated YAMC controls.

2014-07-03 | E-GEOD-55233 | biostudies-arrayexpress

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data