Refining mouse annotations via targeted RNA sequencing
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
SUBMITTER: Giovanni Bussotti
PROVIDER: E-GEOD-72311 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Due to the large size, complex splicing and wide dynamic range of eukaryotic transcriptomes, RNA sequencing samples the majority of expressed genes infrequently, resulting in sparse sequencing coverage that can hinder robust isoform assembly and quantification. Targeted RNA sequencing addresses this challenge by using oligonucleotide probes to capture selected genes or regions of interest for focused sequencing. This enhanced sequencing coverage confers sensitive gene discovery, robust transcript assembly and accurate gene quantification. Here we describe a detailed protocol for all stages of targeted RNA sequencing, from initial probe design considerations, capture of targeted genes, to final assembly and quantification of captured transcripts. Initial probe design and final analysis can take less than a day, while the central experimental capture stage requires ~7 days. Targetted RNA sequencing of long noncoding RNAs
2014-03-01 | E-GEOD-52503 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series
2014-10-01 | E-GEOD-53328 | biostudies-arrayexpress
Project description:Gene splicing requires three basal genetic elements; the 3M-bM-^@M-^Y and 5M-bM-^@M-^Y splice sites and the branchpoint to which the 5M-bM-^@M-^Y intron termini is ligated to form a closed lariat during the splicing reaction. The 5M-bM-^@M-^Y and 3M-bM-^@M-^Y splice sites that define exon boundaries have been widely identified, revealing pervasive transcription and splicing of human genes. However, the locations of the third requisite element, the branchpoint, are still largely unknown. Here we employ two complementary approaches, targeted RNA sequencing and exoribonuclease digestion, to distil sequenced reads that traverse the lariat junction and, via non-conventional alignment, locate human branchpoint nucleotides. Alignments identify 88,748 branchpoints that correspond to 20% of known introns, with 76% supported by diagnostic sequence mismatch errors. This affords a first genome-wide analysis of branchpoints, describing their distribution, selection, and the existence of a diverse array of overlapping sequence motifs with distinct usage, evolutionary histories, and co-variation with distal splicing elements. The overlap of branchpoints with noncoding human genetic variation also indicates a notable contribution to disease. This annotation and analysis incorporates branchpoints into transcriptomic research and reflects a core role for this element in the regulatory code that governs gene splicing and expression. CaptureSeq identification of branchpoint nucleotides
2014-10-01 | E-GEOD-53326 | biostudies-arrayexpress
Project description:Analysis of transcriptomes from 21 tissues, 13 melanoma samples and 7 breast cancer cell lines, enriched for transcripts from haploblocks with intronic and intergenic GWAS SNPs using CaptureSeq.
2017-07-04 | E-MTAB-4519 | biostudies-arrayexpress
Project description:We compared the performance of conventional RNAseq with RNA Capture Sequencing (CaptureSeq) to assemble and quantify known RNA spike-Ins and human transcripts. We find CaptureSeq to be superior for the detection and quantification of the 37% lowest expressed genes, and comparable for the next 45% of moderately expressed genes. CaptureSeq contributes only minor technical variation and measures differential gene expression accurately. We demonstrate these advantages by the targeted sequencing of long noncoding RNAs across 20 human tissues, expanding previous annotations two-fold and simultaneously generating a quantitative atlas of expression. This analysis confirms the use of CaptureSeq as an important method for transcriptional profiling. Long noncoding RNA assembly and expression is analysed by targeted RNA sequencing for 20 human tissues and 4 human cell lines
2015-03-10 | E-GEOD-61474 | biostudies-arrayexpress
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress
Project description:Cerebellar cortex expression in ataxia-telangiectasia patients and normal controls. The neurodegenerative disease known as ataxia-telangiectasia (A-T) is caused by the absence of the ATM (A-T mutated) protein. A long-standing mystery surrounding A-T is why cerebellar Purkinje cells (PCs) appear uniquely vulnerable to ATM-deficiency. Here, we present that 5-hydroxymethylcytosine (5hmC), a newly recognized epigenetic marker found at high levels in neurons, is substantially reduced in human A-T and Atm-/- mouse cerebellar PCs. TET1, an enzyme that converts 5mC to 5hmC, responds to DNA damage. Manipulation of TET1 activity directly affects neuronal cell cycle reentry and cell death after the induction of DNA damage. Quantitative, genome-wide analysis of 5hmC of samples from human cerebellum showed that in ATM-deficiency there is a remarkable genome-wide reduction of 5hmC enrichment at both proximal and distal regulatory elements. These results reveal a role of TET1-mediated 5hmC in DNA damage response, and provide insights into the basis of a PC-specific DNA demethylation alteration in ATM-deficiency. Human frozen tissue was obtained from the NICHD Brain and Tissue Bank of Developmental Disorders at the University of Maryland, Baltimore, MD. RNA was prepared and run on an Illumina Human HT-12 v4 microarray. 3 ataxia-telangiectasia (A-T) cases and 4 normal controls.
2015-10-30 | E-GEOD-61019 | biostudies-arrayexpress
Project description:Exclusion of cancer patients with brain metastases from clinical trials is a major cause of the limited therapeutic options available for secondary brain tumors. Here, we report a novel drug-screening platform (METPlatform) based on organotypic cultures that allows identifying anti-metastatic compounds in a preparation that includes the tumor microenvironment. By applying this approach to brain metastasis, we identified HSP90 as a promising therapeutic target. A blood-brain barrier permeable HSP90 inhibitor showed high potency against mouse and human brain metastases from melanoma, lung and breast adenocarcinoma with distinct oncogenomic profiles at clinically relevant stages of the disease, including a novel model of local relapse after neurosurgery. Furthermore, in situ proteomic analysis of brain metastases treated with the chaperone inhibitor revealed non-canonical clients of HSP90 as potential novel mediators of brain metastasis and actionable mechanisms of resistance driven by autophagy. Our work validates METPlatform as a potent resource for metastasis research integrating drug-screening and unbiased omic approaches that is fully compatible with human samples. We envision that METPlatform could be established as a clinically relevant strategy to personalize the management of metastatic disease in the brain and elsewhere.
2022-03-17 | PXD020092 | Pride
Project description:Human PAK4 is an ubiquitously expressed p21-activated kinase which acts downstream of Cdc42. Since PAK4 is demonstrably enriched in cell-cell junctions, we probed the local protein environment around the kinase with a view to understanding its location and substrates. In U2OS cells expressing PAK4-BirA-GFP the resultant SILAC proximity analyses revealed a subset of 28 proteins that are primarily cell-cell junction components. The protein with highest relative biotin labelling was Afadin/AF6, which associates with the nectin family of homophilic junctional proteins. Reciprocally >50% of the PAK4-proximal proteins were identified by Afadin BioID. Pull-down experiments failed to identify junctional proteins, emphasizing the advantage of the BioID method. Mechanistically PAK4 depended on Afadin for its junctional localization, which is similar to the situation in Drosophila. A highly ranked PAK4-proximal protein LZTS2 was immuno-localized with Afadin at cell-cell junctions. Though PAK4 and Cdc42 are junctional, BioID analysis did not yield conventional cadherins, indicating their spatial segregation. To identify cellular PAK4 substrates we then assessed changes in phospho-proteome after 12 min PF-3758309 treatment. Among the PAK4-proximal junctional proteins 17 PAK4 sites were identified. Thus we show PAK4 is selective for the mammalian Afadin/nectin sub-compartment, with a demonstrably distinct localization from tight and cadherin junctions.
2021-11-30 | PXD024464 | Pride
Project description:Background: Vocal learning is a rare and complex behavioral trait that serves as a basis for the acquisition of human spoken language. In songbirds, vocal learning and production depend on a set of specialized brain nuclei known as the song system. Methodology/Principal Findings: Using high-throughput functional genomics we have identified, 200 novel molecular markers of adult zebra finch HVC Vocal, a key node of the song system. These markers clearly differentiate HVC from the general pallial region to which HVC belongs, and thus represent molecular specializations of this song nucleus. Bioinformatics analysis reveals that several major neuronal cell functions and specific biochemical pathways are the targets of transcriptional regulation in HVC, including: 1) cell-cell and cell-substrate interactions (e.g., cadherin/catenin-mediated adherens junctions, collagen-mediated focal adhesions, and semaphorin-neuropilin/plexin axon guidance pathways); 2) cell excitability (e.g., potassium channel subfamilies, cholinergic and serotonergic receptors, neuropeptides and neuropeptide receptors); 3) signal transduction (e.g., calcium regulatory proteins, regulators of G-protein-related signaling); 4) cell proliferation/death, migration and differentiation (e.g., TGF-beta/BMP and p53 pathways); and 5) regulation of gene expression (candidate retinoid and steroid targets, modulators of chromatin/nucleolar organization). The overall direction of regulation suggest that processes related to cell stability are enhanced, whereas proliferation, growth and plasticity are largely suppressed in adult HVC, consistent with the observation that song in this songbird species is mostly stable in adulthood. Conclusions/Significance: Our study represents one of the most comprehensive molecular genetic characterizations of a brain nucleus involved in a complex learned behavior in a vertebrate. The data indicate numerous targets for pharmacological and genetic manipulations of the song system, and provide novel insights into mechanisms that might play a role in the regulation of song behavior and/or vocal learning. Comparison of HVC and shelf regions from adult male zebra finches, 6 biological replicates per group. Each sample was hybridized against the SoNG universal reference RNA pool.
2012-03-15 | E-GEOD-36270 | biostudies-arrayexpress