Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

47 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcription profiling by array of mouse wild type and Prss16 knockouts

ABSTRACT: Transcription profiling of Prss16 Tssp can be used to evidentiate further endopeptidase genes candidate to self-peptide generation in the thymus. All mice studied were C57BL/6 background and KO (knockout) Prss16-deficient mice were previously obtained by homologous recombination in embryonic stem (ES) cells of a targeting vector carrying Neo resistance gene marker, which has allowed replacement of exons 8 to 12 of the Prss16 gene in KO mice (data not shown). Briefly, one properly targeted ES clone was injected into BALB/c blastocysts to generate chimeric mice. Chimeric males were mated to C57BL/6 females to generate heterozygous pups in which the Neo selection cassette had been excised. Mice heterozygous for the mutation,originally on mixed 129/Sv x C57BL/6 genetic background, were intercrossed to generate homozygous mutants (Prss16-/-), WT (Prss16+/+) and heterozygousmutants (Prss16+/-) littermates. Genotype analysis was performed on genomic DNA from tail biopsies using PCR primers F (5M-^R GCCTGACACAAGTCGCCATAGG 3M-^R),R1 (5M-^R CCAGTTCCTCCCTCAGCACAG 3M-^R) and R2 (5M-^R CCAGTAAGAGTGAGGTCCAGAC 3M-^R). The WT Prss16 allele was visualized as a 600 bp fragment using the F-R1 pair ofprimers, whereas the mutant allele was visualized as a 447 bp fragment using the F-R2 pair of primers. Absence of mRNA expression in the thymus of Prss16-/- mice was confirmed by northern-blot using a cDNA probe (data not shown). The Prss16 deficient mice were crossed onto a C57BL/6 background for eightgenerations and the thymi of the resulting mice were used for analysis.

ORGANISM(S): Mus musculus

SUBMITTER: Geraldo Passos

PROVIDER: E-MEXP-2829 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Transcription profiling of lymph node from mice with collagen induced arthritis in response to the endothelin receptor antagonist Bosentan

Project description:DBA/1J mice (12 wk old; weighing 18-22 g) were housed in temperature-controlled rooms (22-25 C) in the animal facility of the School of Medicine of Ribeir o Preto, University of Sao Paulo, Sao Paulo, Brazil, and received water and food ad libitum. Male DBA/1J mice received 200 g of bovine type II collagen (CII) in CFA by intradermal injection (day 0). Collagen (200 ?g in PBS) was given again on day 21 by i.p. injection. Mice were monitored daily for signs of arthritis for which severity scores were derived as follows: 0=normal, 1=erythema, 2=erythema plus swelling, 3= extension/loss function and total score = sum of four limbs. Disease onset characterized by erythema and/or paw swelling was seen between days 25 and 35. For the therapeutic approach, DBA/1 mice were treated with Bosentan (100 mg kg-1) p.o. or vehicle once a day for a total of 11 days. The treatment began on day that CIA became clinically detectable. The DBA-1/J mice were sacrificed preferentially by CO2 inhalation, and the lymph nodes removed. To obtain sufficient mRNA for hybridization to the glass slides, total inguinal lymph nodes RNA was pooled from three mice at each time point (2 inguinal lymph nodes per mouse). Total RNA samples were prepared using Trizol® reagent according to the manufacturers instructions. Undegraded and DNA-, protein- and phenol-free RNA preparations were verified by classic agarose gel electrophoresis stained with ethidium bromide and ultraviolet spectrophotometry, respectively.

2009-10-20 | E-MEXP-2404 | biostudies-arrayexpress

Transcription profiling of mouse thymus in pre diabetic and diabetic state of NOD (non obese diabetic) animal strain

Project description:The current project is within the range of molecular immunogenetic auto immune diseases and refers to the comparative study of promiscuous gene expression of tissue-specific antigens (TSAs) in the thymus of NOD mice line (non obese diabetic) who plays the auto-immune diabetes mellitus type 1, during the transition from state pre-diabetics to diabetics. Use the technology of oligo arrays to investigate the expression of miRNAs and cDNA microarrays to investigate the expression of genes encoding the messenger RNAs including TSAs (tissue specific antigens). Use the technology of oligo arrays to investigate the expression of miRNAs and cDNA microarrays to investigate the expression of genes encoding the messenger RNAs including TSAs (tissue specific antigens). Female NOD mice were born in specific pathogen free (SPF) conditions at the CEMIB-UNICAMP animal facility (University of Campinas, SP, Brazil) and maintained in SPF mini-isolators in our laboratory at the University of Sï¿½o Paulo, Campus of Ribeirï¿½o Preto, Brazil. We studied both pre-diabetic (8ï¿½2 week-old) and diabetic (20ï¿½2 week-old) animals. Diabetes was confirmed by blood glucose levels (?250 mg glucose/dL) using the Accu Check ï¿½ Active Kit (Roche Diagnï¿½stica Brasil, Sï¿½o Paulo, Brazil). The thymic stroma was separated from the whole thymus, as previously described (Gray et al. 2002). The central idea is to trace signatures of differential gene expression of the thymus at different stages (transition from state pre-diabetics to diabetics) and, using bioinformatics programs, applied to the analysis of data from arrays [Cluster & Tree View (for signatures of expression), SAM (for statistical analysis of the miRNAs and differentially expressed genes from TSAs), GenMiR++ and Cytoscape (to establish networks between miRNAs genes and genes of TSAs)].

2009-10-14 | E-MEXP-2321 | biostudies-arrayexpress

Transcription profiling of mouse thymus glandwfrom normal and ollagen induced arthritis animals

Project description:DBA/1J and DBA-2/J mice (12-14 weeks old) weighing 18ï¿½22 g were housed in temperature-controlled rooms (22ï¿½25ï¿½C) in the animal facility of the School of Medicine of Ribeirï¿½o Preto, University of Sï¿½o Paulo, Sï¿½o Paulo, Brazil, and received water and food ad libitum. DBA/1J and DBA-2/J male mice were used in type II collagen immunizations. For CIA, at day zero, DBA/1J males were intradermally injected at the base of the tail with 200 ï¿½g of bovine type II collagen (CII) (Sigma) in 100ï¿½l of 0.05 M acetic acid emulsified with equal volume of complete Freundï¿½s adjuvant (Chondrex, Redmond, WA). On day 21, a second injection of CII (200 ï¿½g in acetic acid) was given intraperitoneally (i.p). DBA/2J males were also immunized with CII and served as controls. A caliper was used to determine the paw diameter and swelling was determined as the increase in diameter compared to day zero of immunization. The thymic stroma was separated from the whole thymus. The mTEC 3.10 medullary thymic epithelial cell line was established from C57BL/6 mice, and the original medullary phenotype was confirmed by immunostaining with anti-cytokeratin monoclonal antibodies. In addition, the CD80+ phenotype was confirmed using fluorescent activated cell sorting (FACS) analysis. Cells were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37oC and 5% CO2. Total RNA was extracted from 1x107 stromal cells and from 1x107 mTEC 3.10 cells using Trizolï¿½ Reagent and following the manufacturerï¿½s instructions (Invitrogen, Carlsbad, CA, USA). RNA preparations were confirmed to be free of proteins and phenol using UV spectrophotometry and the state of degradation was assessed using agarose gel electrophoresis (ethidium bromide staining).

2009-10-01 | E-MEXP-2338 | biostudies-arrayexpress

Transcription profiling of mouse thymus gland from pre-diabetic and diabetic animals.

Project description:Female NOD mice were born in specific pathogen free (SPF) conditions at the CEMIB-UNICAMP animal facility (University of Campinas, Sï¿½o Paulo, Brazil) and maintained in SPF mini-isolators in our laboratory at the University of Sï¿½o Paulo, Campus of Ribeirï¿½o Preto, Brazil. We studied both pre-diabetic (8ï¿½2 week-old) and diabetic (20ï¿½2 week-old) animals. Diabetes was confirmed by blood glucose levels (?250 mg glucose/dL) using the Accu Check ï¿½ Active Kit (Roche Diagnï¿½stica Brasil, Sï¿½o Paulo, Brazil). The thymic stroma was separated from the whole thymus. The mTEC 3.10 medullary thymic epithelial cell line was established from C57BL/6 mice, and the original medullary phenotype was confirmed by immunostaining with anti-cytokeratin monoclonal antibodies. In addition, the CD80+ phenotype was confirmed using fluorescent activated cell sorting (FACS) analysis. Cells were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37oC and 5% CO2. Total RNA was extracted from 1x107 stromal cells (from pre-diabetic and diabetic animals) and 1x107 mTEC 3.10 cells using Trizolï¿½ Reagent and following the manufacturerï¿½s instructions (Invitrogen, Carlsbad, CA, USA). RNA preparations were confirmed to be free of proteins and phenol using UV spectrophotometry and the state of degradation was assessed using agarose gel electrophoresis (ethidium bromide staining).

2009-11-16 | E-MEXP-2339 | biostudies-arrayexpress

Differential gene expression profile may differentiate responders from non-reponders rheumatoid arthritis patients to methotrexate monotherapy and methotrexate plus TNF-blocker combined therapy

Project description:Oligo microarrays were used to access the transcription profiling of the rheumatoid arthritis patients under two different therapeutic approaches, aiming to evaluate if the cDNA microarray study is able to differentiate responders and non-responders to therapies. In the first experiment (MTX therapy) we analyzed 25 patients from which 8 were classified as MTX responders and 17 MTX non-responders. In the second experiment from the 17 MTX non-responder patients, 8 were non-responders and 9 were responders to additional anti-TNF therapy.

2011-12-31 | E-MEXP-3390 | biostudies-arrayexpress

Transcription Regulatory Networks of CD4 CD8 and CD14 cells in Patients of Type I Mellitus Diabetes

Project description:Insulin-dependent diabetes mellitus (T1D) is an organ-specific auto-immune disease caused by the selective destruction of the pancreatic beta cells by inflammatory cells, especially auto-reactive CD8+ T lymphocytes. In this study we evaluated the differential large scale gene expression profiling using cDNA microarrays of T (CD4+ and CD8+) and monocyte (CD14+) cells. In addition, considering that HLA class II profile may influence the expression of these molecules on the surface of peripheral blood cells, and considering that the mechanisms by which HLA class II susceptibility alleles drive the auto-immune response have not been elucidated, we intend to further stratify T1D patients according to the HLA class II profile. 20 pre-pubertal recently diagnosed T1D patients were selected, HLA-DRB1/DQB1 allele typing and separated in two groups. The group 1(G1) had patients with susceptibility alleles and group 2 (G2) with at least one protection allele. To established relationships between genes, the GeneNetwork 1.2 algorithm was used, 6 networks were obtained, TCD4+ G1 patients X controls, TCD4+ G2 patients X controls, and same situation to TCD8+ and CD14+.

2011-06-15 | E-MEXP-3223 | biostudies-arrayexpress

Undifferentiated pulp cells and odontoblast-like cells share genes involved in the process of odontogenesis.

Project description:Undifferentiated pulp cells and odontoblast-like cells share genes involved in the process of odontogenesis.

2012-08-15 | E-MEXP-3637 | biostudies-arrayexpress

Transcription profiling by array of human bladder cancer cell lines with or without TP53 mutations

Project description:The established cell lines RT4, 5637 and T24 from human bladder TCC were obtained from the Cell Bank of the Federal University of Rio de Janeiro, Brazil. The 5637 cells harbor two TP53 mutations, at codon 72 (Arg . Pro) and codon 280 (Arg . Thr).T24 cells contain a TP53 allele encoding an in-frame deletion of tyrosine 126. Both cell lines were established from high-grade bladder tumors. No specific mutations were detected in RT4 cells, which had been established from a low-grade papillary bladder tumor. The RT4 and T24 cell lines were maintained in DulbeccoM-^Rs modified EagleM-^Rs medium (Sigma-Aldrich, Inc, St Louis, MO, USA), and the 5637 cells were kept in Roswell Park Memorial Institute medium (Sigma-Aldrich). Both media were supplemented with 10% fetal bovine serum (Cultilab Ltd, Campinas, Brazil), 100 U/mL penicillin G (Sigma-Aldrich), 100 U/mL streptomycin (Sigma-Aldrich) and 1% kanamycin sulfate (Amresco, Branded Products Group, Solon, OH, USA); cells were cultured at 37M-:C in an atmosphere of 5% CO2. A pooled reference design was chosen. More specifically, each array was hybridized with the same reference sample labeled with Cy5, while the experimental samples (control or treated) were labeled with Cy3.

2010-10-30 | E-MEXP-2859 | biostudies-arrayexpress

Transcription profiling of Mycobacterium tuberculosis infected mice treated or non-treated with DNA-HSP65 vaccine treatment

Project description:Comparision of Mycobacterium tuberculosis infected mice treated or non-treated with DNA-HSP65 vaccine treatment

2008-11-01 | E-MEXP-944 | biostudies-arrayexpress

Portrait of Transcriptional Expression Profiles Displayed by Different Glioblastoma Cell Lines

Project description:Comparison of gene expression profiles displayed by four Glioblastoma cell lines, differing mainly by TP53 mutation, in the absence of any kind of treatment.

2011-12-26 | E-MEXP-3200 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data