Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Transcription profiling of C. elegans small RNA cloning and array methods for reproducibility and quantitation

ABSTRACT: This experiment was for the purpose of testing our small RNA cloning and array methods for reproducibility and quantitation (see Axtell and Bartel). This experiment consists of four hybridizations of C. elegans small RNA. Hybridizations test a Cy3-labeled biological sample against a constant, synthetic reference sample (Cy5). Two technical replicates are used; two indepedent clonings and labelings of small RNAs from a C. elegans wild-type, mixed stage RNA sample, and two from glp-4(bn2) worms. This experiment tested the technical reproducibility of the array at two different hyb temperatures, 50C and 57C. Biological samples were labeled Cy3, while a constant, synthetic reference sample was labeled Cy5.

ORGANISM(S): synthetic DNA

SUBMITTER: David Bartel

PROVIDER: E-MEXP-291 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Antiquity of microRNAs and their targets in land plants.

Axtell Michael J MJ Bartel David P DP

The Plant cell 20050422 6

MicroRNAs (miRNAs) affect the morphology of flowering plants by the posttranscriptional regulation of genes involved in critical developmental events. Understanding the spatial and temporal dynamics of miRNA activity during development is therefore central for understanding miRNA functions. We describe a microarray suitable for detection of plant miRNAs. Profiling of Arabidopsis thaliana miRNAs during normal development extends previous expression analyses, highlighting differential expression o ...[more]

PMID: 15849273

Similar Datasets

Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').

Dataset Information

Transcription profiling of C. elegans small RNA cloning and array methods for reproducibility and quantitation

Publications

Antiquity of microRNAs and their targets in land plants.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets