Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Nanopore sequencing reveals endogenous NMD-targeted isoforms in human cells

ABSTRACT: Nonsense-mediated mRNA decay (NMD) is a eukaryotic, translation-dependent degradation pathway that targets mRNAs with premature termination codons and also regulates the expression of some mRNAs that encode full-length proteins. Although many genes express NMD-sensitive transcripts, identifying them based on short-read sequencing data remains a challenge. To identify and analyze endogenous targets of NMD, we applied cDNA Nanopore sequencing and short-read sequencing to human cells with varying expression levels of NMD factors. Our approach detects full-length NMD substrates that are highly unstable and increase in levels or even only appear when NMD is inhibited. Among the many new NMD-targeted isoforms that our analysis identified, most derive from alternative exon usage. The isoform-aware analysis revealed many genes with significant changes in splicing but no significant changes in overall expression levels upon NMD knockdown. NMD-sensitive mRNAs have more exons in the 3΄UTR and for mRNAs with a termination codon in the last exon. The length of the 3΄UTR per se does not correlate with NMD sensitivity. Analysis of splicing signals reveals isoforms where NMD has been co-opted in the regulation of gene expression, but a main function is most likely to rid the transcriptome of isoforms resulting from spurious splicing events. Long-read sequencing enabled the identification of many novel NMD-sensitive mRNAs and revealed both known and unexpected features concerning their biogenesis and their biological role. Our data provide a highly valuable resource of human NMD transcript targets for future genomic and transcriptomic applications.

INSTRUMENT(S): GridION

SUBMITTER: Foivos Gypas

PROVIDER: E-MTAB-10452 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.

Project description:Genome-wide association studies (GWASs) have revealed thousands of associations in many complex traits and diseases. Previous studies suggest that a subset of associations are due to alterations in splicing; however, interpreting the effects of splicing on protein isoforms is hindered by limitations in defining full-length transcript isoforms using short-read RNA-seq data. Long-read RNA-seq represents a powerful approach to define and quantify transcript isoforms. In this study, we developed a novel approach that integrates information from GWAS, splicing QTL (sQTL), and PacBio long-read RNA-seq in a disease relevant model to infer the effects of sQTL on the ultimate protein isoform products they encode. Such information enables identification of genes potentially responsible for GWAS associations. As a proof-of-concept, we generated deep coverage (N=~22 million full-length reads) PacBio long-read RNAseq data on human fetal osteoblasts (hFOBs), a cell-line of relevance to the regulation of bone mineral density (BMD). We identified 68,326 protein-coding isoforms, including 17,375 (25%) which were novel. Next, we used Bayesian colocalization to identify 1,863 sQTLs from the Genotype-Tissue Expression (GTEx) project in 732 protein-coding genes which colocalized with BMD associations (H4PP > 0.75). A total of 836 junctions with colocalizing sQTLs in 459 (of the 732) genes were expressed in hFOB long-read RNA-seq data. With these data, we formulated hypotheses regarding the potential mechanism of action of each sQTL. For example, we identified 7 junctions with colocalizing sQTLs (maximum H4PP = 0.98-0.99) in TPM2 for splice junctions between two nearly mutually exclusive exons, and two different transcript termination sites, making it impossible to interpret without long-read RNA-seq data. siRNA mediated knockdown in hFOBs showed two TPM2 isoforms with opposing effects on mineralization. Our results suggest that splicing is a major mechanism underlying GWAS associations and long-read proteogenomics data is critical to precisely define the protein isoforms that are produced from splicing alterations.

Dataset Information

Nanopore sequencing reveals endogenous NMD-targeted isoforms in human cells

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets