RNA stearic HT29
Ontology highlight
ABSTRACT:
INSTRUMENT(S): NextSeq 2000
ORGANISM(S): Homo sapiens
SUBMITTER: Aurelien Ginolhac
PROVIDER: E-MTAB-14429 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:HT29 cells was infected with EV71 at MOI 1 or nil respectively and harvested at 36hpi We use miRNA microarray to profile and identify miRNA which are up or down regulated due to EV71 infection 3 biological replicate (6 samples)
2014-05-08 | E-GEOD-57372 | biostudies-arrayexpress
Project description:The experiment contains CUT&Tag profiles for transcription factor HNF4A in HT29 cell line treated with shRNA for PINK1. The experiment also include a control profile for HNF4A in HepG2 cell line.
2024-06-15 | E-MTAB-13597 | biostudies-arrayexpress
Project description:miRNAs exert various biological functions by targeting different cellular targets. Studying miR-146a functions in colon cancer cells helps to understand colorectal cancer (CRC) malignancy and progression. HT29 miR-146a-expressing cells and empty control cells were established for mining the gene expression profiles upon miR-146a expression.
2013-11-20 | E-GEOD-37596 | biostudies-arrayexpress
Project description:Our previous proteomics analysis suggested down-regulation of mitochondrial aconitase (ACO2) plays an important role in colorectal cancer. To evaluate the effect of mitochondrial aconitase overexpression on the metabolic and signaling pathway changes in colon cancer cell line HT29, we generated two ACO2 overexpressing cell lines #C and #UD and the mock-transfected vector control #VE. HT29 colon cancer cells overexpressing ACO2 exhibited lower rate of cell proliferation in vitro and reduced tumor growth potential in nude mice. In order to understand the signaling pathway changes, cDNA microarray analysis using GeneChips from Affymetrix were carried out.
2010-01-14 | E-MEXP-1996 | biostudies-arrayexpress
Project description:The WWOX gene is a tumor suppressor probably involved in regulation of cell cycle and apoptosis and downregulated in variety of cancer types.However, its role in colon cancerogenesis is unknown. The aim of this study was to characterize how WWOX may be involved in colon cancerogenesis or cancer progression, how it influences the basic cancer cell features and modifies cell expression profile.Our observations suggest that in HT29 colon cancer cell line increased expression of WWOX may result in transition of cancer cells into more normal- like colon epithelium phenotype, on the other hand in SW480 WWOX revealed the well-known tumour suppressor properties. However, as the colon cancer is very heterogeneous disease, obtained discrepancies may reflect the known differences between cell lines and cancerogenesis pathway, which they undergone. HT29 colon cancer cells were stably transfected with WWOX cDNA. HT29 cells transfected with an empty vector served as a control. Total mRNA was isolated to look for gene-expression differences induced by the WWOX overexpression.
2014-01-23 | E-GEOD-54298 | biostudies-arrayexpress
Project description:Transcription profiling of human colorectal carcinoma cell lines HCT116 and HT29 treated with 5-ASA
2009-11-16 | E-TABM-768 | biostudies-arrayexpress
Project description:We report the results of knockdowm ETV5 in human CRC celllines HT29, we built 3 controls and 3 experimental cases
2021-04-03 | GSE112628 | GEO
Project description:HT29 cells were transsfected with siRNA (siHX), which is targeting the human endogeous retrovirus HERV-HX. Cells were harvested 72 h after transfection and knock-down of HERV-HX was evaluated by quantitative RT-PCR. Experiment Overall Design: Two-condition experiment, siHX vs. control cells. 1 transfected, 1 control.
2009-01-14 | E-GEOD-14257 | biostudies-arrayexpress
Project description:Background The Ca2+-dependent C-type lectin receptor Macrophage Galactose-type Lectin (MGL) is highly expressed by tolerogenic dendritic cells (DC) and macrophages. MGL exhibits a high binding specificity for terminal alpha- and beta-linked GalNAc residues found in Tn, sTn and LacdiNAc antigens. These glycan epitopes are often overexpressed in colorectal cancer (CRC), and, as such, MGL can be used to discriminate tumor from the corresponding healthy tissues. Moreover, the high expression of MGL ligands is associated with poor disease-free survival in stage III of CRC tumors. Nonetheless, the glycoproteins expressed by tumor cells that are recognized by MGL have hitherto remained elusive. Methods Using a panel of three CRC cell lines (HCT116, HT29 and LS174T), recapitulating CRC diversity, we performed FACS staining and pull-down assays using a recombinant soluble form of MGL (and a mutant MGL as control) combined with mass spectrometry-based (glyco)proteomics. Results HCT116 and HT29, but not LS174T, are high MGL-binding CRC cell lines. On these cells, the major cell surface binding proteins are receptors (e.g. MET, PTK7, SORL1, PTPRF) and integrins (ITGB1, ITGA3). From these proteins, several N- and/or O-glycopeptides were identified, of which some carried either a LacdiNAc or Tn epitope.
2020-01-09 | PXD016726 | Pride
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress