Capture-C identification of chromatin interactions of 53 selected cellular loci prior to and post induction of EBV's lytic cycle in Raji cells
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina HiSeq 1500
ORGANISM(S): Homo sapiens
SUBMITTER: Alexander Buschle
PROVIDER: E-MTAB-7825 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:One of the strongest associated type 2 diabetes (T2D) loci reported to date resides within the TCF7L2 gene. Previous studies point to the T allele of rs7903146 in intron 3 as the causal variant at this locus. To aid in the identification of the actual gene(s) under the influence of this variant, we first generated a CRISPR/Cas9 mediated 1.4kb deletion of the genomic region harboring rs7903146 in the HCT116 cell line followed by global gene expression analysis (see experiment E-MTAB-4839). We then carried out high-throughput chromosome conformation capture assays in the HCT116 and NCM460 cell lines and in colon tissue in order to ascertain which of these perturbed genes promoters made consistent physical contact with the genomic region harboring the variant. To assess consistency and reproducibility we utilized two different techniques: Circularized Chromosome Conformation Capture (4C) and Capture C. In both types of assays, after preparing 3C libraries, our bait of interest was the region harboring rs7903146. Loci interacting with such bait are enriched for by inverse PCR in 4C and by oligonucleotide capture in capture C. 4C assays were carried out in the following samples: two on NCM460 cells (using different primer sets), one on HCT116 cells, one on HCT116 cells with a CRISPR/Cas9 mediated 1.4kb deletion of the genomic region harboring the SNP rs7903146, and one on colon tissue. Capture C assays were carried out in one sample each of the cell lines NCM 460 and HCT116. This experiment, coupled with the associated E-MTAB-4839, revealed just one gene, ACSL5, which resides in the same topologically associating domain as TCF7L2.
2016-08-15 | E-MTAB-4845 | biostudies-arrayexpress
Project description:We employed a massively parallel, high resolution Capture-C based method to simultaneously characterize the genome-wide interactions of all human promoters in any cell type. We applied this approach to study the promoter interactome of HepG2 cells (3 biological replicates). We designed a custom Agilent SureSelect library targeting both ends of DpnII restriction fragments that overlap promoters of protein-coding, noncoding, antisense, snRNA, miRNA, snoRNA and lincRNA transcripts. Each library was sequenced on 4 lanes of an Illumina HiSeq 4000.
2019-03-20 | E-MTAB-7144 | biostudies-arrayexpress
Project description:Genome Wide Association Studies (GWAS) have been successful in yielding >60 loci for Systemic Lupus Erythematosus (SLE). However, it is known that GWAS just reports genomic signals and not necessarily the precise localization of culprit genes, with eQTL efforts only able to infer causality to a minority of such loci. Thus, we sought to carry out physical and direct ‘variant to gene mapping’ by integrating results from high-throughput chromatin conformation capture and ATAC-seq assays. This experiment refers to the chromatin conformation capture part of our work. Detecting contacts between distant regions of the genome offers a powerful opportunity to understand GWAS signals that principally reside in non-coding regions, and thus likely act as regulatory elements for neighboring genes. To move beyond analyzing one locus at a time and to improve on the low resolution of available Hi-C data, we employed a massively parallel, high resolution Capture-C based method to simultaneously characterize the genome-wide interactions of all human promoters in any cell type. We applied this approach to study the promoter ‘interactome’ of primary human T Follicular Helper (TFH) cells from tonsils of healthy volunteers (3 biological replicates), a model relevant to SLE as TFH operate upstream of the activation of pathogenic autoantibody-producing B cells during the disease. We also analyzed the promoter interactome of naive CD4-positive helper T cells (3 biological replicates). We designed a custom Agilent SureSelect library targeting both ends of DpnII restriction fragments that overlap promoters of protein-coding, noncoding, antisense, snRNA, miRNA, snoRNA and lincRNA transcripts. Each library was sequenced on 8 lanes of an Illumina HiSeq 4000.
2020-05-12 | E-MTAB-6621 | biostudies-arrayexpress
Project description:All eukaryotes studied to date have the capacity to detect and degrade mRNAs harboring premature translation termination codons (PTCs) in a process called nonsense-mediated mRNA decay (NMD) (reviewed in Wagner E & Lykke-Andersen J, 2002). This surveillance system allows the cell to prevent the expression of potentially harmful truncated proteins. trans-acting factors required for NMD in Drosophila are the proteins UPF1, UPF2, UPF3, SMG-1, SMG-5 and SMG-6. To identify mRNAs naturally regulated by NMD, we analyzed expression profiles in Drosophila cells RNAi-depleted of known NMD factors using high-density oligonucleotide arrays.
2005-11-01 | E-MEXP-202 | biostudies-arrayexpress
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:Chromatin Immunoprecipitation followed by sequencing (ChIP-seq) has been instrumental to our current view of chromatin structure and function. It allows genome-wide mapping of histone marks, which demarcate biologically relevant domains. However, ChIP-seq is an ensemble measurement reporting the average occupancy of individual marks in a cell population. Consequently, our understanding of the combinatorial nature of chromatin states relies almost exclusively on correlation between the genomic distributions of individual marks. Here, we report the development of Combinatorial-iChIP to determine the genome-wide co-occurrence of histone marks at single nucleosome resolution. By comparing to null model, we show that certain combinations of overlapping marks (H3K36me3 and H3K79me3) co-occur more frequently than expected by chance, while others (H3K4me3 and H3K36me3) do not, reflecting differences in the underlying chromatin pathways. We further use combinatorial-iChIP to illuminate aspects of the Set2-RPD3S pathway. This approach promises to improve our understanding of the combinatorial complexity of chromatin. Combinatorial iChIP in yeast.
2016-08-02 | E-GEOD-84240 | biostudies-arrayexpress
Project description:Drosophila Insulator proteins mediate long-range chromosomal interactions. ChIP-seq revealed that binding of insulator proteins to some specific DNA sites was regulated by poly(ADP-ribosyl)ation in S2 cells. Three insulator sites regulated by poly(ADP-ribosyl)ation were used as baits to map their distant interacting sites using 4C assay in control S2 cells. Mapping the chromosomal interactions of three specific insulator binding sites with 4C assay in control S2 cells.
2013-09-15 | E-GEOD-50768 | biostudies-arrayexpress
Project description:Capture-C of primary human mesenchymal stem cells (MSC)-derived osteoblasts from healthy donors (differentiated with BPM2)
2019-03-20 | E-MTAB-6862 | biostudies-arrayexpress
Project description:THO2 and HPR1 proteins were co-depleted from Drosophila S2 cells and their role in mRNA export analysed by comparing total RNA and cytoplasmic RNA
2005-01-01 | E-MEXP-88 | biostudies-arrayexpress
Project description:We analyzed mRNA expression profiles in Drosophila melanogaster S2 cells that had been depleted of proteins known as mRNA decapping co-activators. mRNA decapping is catalyzed by DCP2, and DCP2 activity is stimulated by decapping co-activators. This group of proteins includes DCP1, Hedls (also known as Ge-1), LSm16 (also known as EDC3), rck/p54 (also known as DHH1 or Me31B), Pat1, and the heptameric LSm1-7 complex. We used the RNA interference technology to deplete cultured S2 cells of DCP1 (CG11183), Ge-1 (CG6181), Pat1 (CG5208), LSm16 (CG6311), and LSm1 (CG4279). We used Affymetrix oligonucleotide microarrays to analyze two independent samples for each depletion. We included the following controls: mock RNAi treatment and GFP dsRNA treatment (two profiles each). We also profiled AGO1 (CG6671) depleted cells (3 independent samples). AGO1 is a key protein required for miRNA-mediated gene silencing. We had shown previously that silencing by miRNAs involves decapping of target mRNAs.
2007-09-03 | E-MEXP-1012 | biostudies-arrayexpress