A genetics screen highlights emerging roles for CPL3, RST1 and URT1 in RNA metabolism and silencing (small RNA profiling part)
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina HiSeq 2500
ORGANISM(S): Arabidopsis thaliana
SUBMITTER: Plant Systems Biology data submission
PROVIDER: E-MTAB-7874 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:CPL3, RST1 and URT1 are three new genes involved in RNA metabolism and suppressing RNA silencing in Arabidopsis. To investigate how transcripts and small RNAs varies in the absence of them, RNA and small RNA sequencing were performed on the shoot tissues of 17-day-old EMS mutants of CPL3, URT1 or RST1 and control line.
2019-04-25 | E-MTAB-7873 | biostudies-arrayexpress
Project description:To analyse the impact of URT1-mediated uridylation on miRNA and siRNA tailing, we deep-sequenced small RNA libraries for WT and urt1 duplicate samples at the same developmental stage that was analyzed by TAIL-seq, i.e., two-week-old seedlings. Examination of miRNA and siRNA tailing in WT and urt1 samples.
2016-03-11 | E-GEOD-72456 | biostudies-arrayexpress
Project description:The present study provides the first large-scale characterization of miRNAs in M. amblycephala and miRNA profile of M. amblycephala with different growth performance. The discovery of miRNA resource from this study is expected to contribute to a better understanding of the miRNAs roles playing in regulating the growth biological processes in fish and the study of miRNA function and phenotype-associated miRNA identification in fish. To investigate the functions of miRNAs associated with growth of M. amblycephala, we adopted the Solexa sequencing technology to sequence two small RNA libraries prepared from four growth related tissues (brain, pituitary, liver and muscle) of M. amblycephala using individuals with relatively high and low growth rates.
2014-05-25 | E-GEOD-51638 | biostudies-arrayexpress
Project description:MicroRNAs (miRNAs) are a class of small non-coding RNAs that function as post-transcriptional regulators of gene expression. Many miRNAs are expressed in the developing brain and regulate multiple aspects of neural development including neurogenesis, dendritogenesis and synapse formation. Rett syndrome (RTT) is a progressive neurodevelopmental disorder caused by mutations in the gene encoding Methyl-CpG binding protein 2 (MECP2). While Mecp2 is known to act as a global transcriptional regulator, miRNAs that are directly regulated by Mecp2 in the brain are not known. Using massively parallel sequencing methods, we have identified miRNAs whose expression is altered in cerebella of Mecp2-null mice before and after the onset of severe neurological symptoms. In vivo genome-wide analyses indicate that promoter regions of a significant fraction of dys-regulated miRNA transcripts, including a large polycistronic cluster of brain-specific miRNAs, are DNA methylated and directly bound by Mecp2. Functional analysis demonstrates that the 3’ untranslated region (UTR) of messenger RNA encoding Brain-derived neurotrophic factor (Bdnf) can be targeted by multiple miRNAs aberrantly up-regulated in absence of Mecp2. Taken together, these results suggest that dys-regulation of miRNAs may contribute to RTT pathoetiology, and also provide a valuable resource to further investigate the role of miRNAs in RTT. Two pooled total RNA samples (4 pairs of wild-type (WT) and Mecp2-null (KO) male mice; postnatal 6-week, the pre-/early-symptomatic stage) were sequenced in a multiplexed configuration (with distinct barcode sequences). And, six samples (two litters, one WT and two KO male mice in each litter; postnatal 8-week, the symptomatic stage) were sequenced individually.
2010-09-29 | E-GEOD-24320 | biostudies-arrayexpress
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:We report that rice endosperm shows a specific hypomethylation of DNA in the maternal genome, preferring regions of high DNA accessibility. Maternally expressed imprinted genes are enriched for hypomethylation at putative promoter regions and transcriptional termini, and paternally expressed genes at promoters and gene bodies, mirroring our recent results in A. thaliana. However, unlike in A. thaliana, rice endosperm sRNA populations are dominated by specific strong sRNA-producing loci, and imprinted 24-nt sRNAs are expressed from both parental genomes and correlate with hypomethylation. Overlaps between imprinted sRNA loci and imprinted genes expressed from opposite alleles suggest that sRNAs may regulate genomic imprinting. Whereas sRNAs in seedling tissues primarily originate from small Class II (cut and paste) transposable elements, those in endosperm are much more uniformly derived, including sequences from other TE classes, as well as genic and intergenic regions. Our data indicate that the endosperm exhibits a unique pattern of sRNA expression and suggest that demethylation of maternal endosperm DNA is conserved in flowering plants. Examination of DNA methylation and small RNA expression in the seeds of two cultivars from the japonica subspecies of Oryza sativa L.
2013-05-01 | E-GEOD-44898 | biostudies-arrayexpress
Project description:The male sterility of thermosensitive genic male sterile (TGMS) lines of wheat (Triticum aestivum) is strictly controlled by temperature. The early phase of anther development is especially susceptible to cold stress. MicroRNAs (miRNA) play an important role in plant development and in responses to environmental stress. In this study, deep sequencing of small RNA (smRNA) libraries obtained from spike tissues of the TGMS line under cold and control conditions identified a total of 81 unique miRNA sequences from 30 families, and trans-acting small interfering RNAs (tasiRNAs) derived from two TAS3 genes. We identified 26 targets of 16 miRNA families and three targets of tasiRNAs. Comparing smRNA sequencing datasets and TaqMan qPCR results, we identified six miRNAs and one tasiRNA (tasiRNA-ARF) as cold stress-responsive smRNAs in spike tissues of the TGMS line. We also determined the expression profiles of target genes that encode transcription factors in response to cold stress. Interestingly, expressions of cold-stress responsive smRNAs integrated in the auxin-signaling pathway and their target genes were largely anticorrelated. We investigated tissue-specific expression of smRNAs using a tissue microarray approach. Our data indicated that miR167 and tasiRNA-ARF play roles in regulating the auxin-signaling pathway, and possibly in the developmental response to cold stress. These data provide evidence that smRNA regulatory pathways are linked with male sterility in the TGMS line during cold stress. Examination of 7 small RNA libraries in spike tissues during cold and control condition
2012-03-29 | E-GEOD-36867 | biostudies-arrayexpress
Project description:Total RNA was isolated from different tissues (leaf, stem and flesh, rind and placenta of the fruits) using TRIzol reagent and small RNA libraries were generated from four cucurbit species: bottle gourd (Lagenaria siceraria (accession Grif 1617 collection from India)), Cucurbita moschata (accession Grif 14244 Early Butternut) Cucurbita pepo (accession NSL98075 Table King), and watermelon (Citrullus lanatus var. lanatus) (PI 438676 Charleston Grey) by pooling equimolar amounts of total RNA from the aforesaid tissues. Construction of small RNA libraries from size fractionated RNA was carried out as described previously. In brief, small RNA fractions of 18–28 nt were isolated from 15% denaturing polyacrylamide gels and sequentially ligated to 5? and 3? RNA adapters. Small RNAs ligated with adapters were converted to DNA by RT-PCR following Solexa protocol. The final PCR product was gel purified and sequenced by Genome Analyser II (Illumina). Examination of small RNA transcriptomes in four plants species using Illumina/Solexa GA-II.
2012-08-02 | E-GEOD-38176 | biostudies-arrayexpress
Project description:Small non-coding RNAs play important roles in regulating gene expression during development and disease. However, a comprehensive analysis of small RNAs in developing brain is largely lacking. By using next-generation sequencing technique, we carried out a systematic analysis of small RNA transcriptome of rat neocortex from early developmental stage till adult. Our results revealed an extraordinary degree of stage-specific profiling of miRNA, and other classes of small RNAs including snoRNA, rasRNA, scRNA and unexpectedly piRNA, which was considered to be solely expressed in germline tissues. Developmentally regulated miRNA editing was also observed. This study further showed the effectiveness of the high through-put sequencing in genome-wide analysis of small RNAs. The dataset described here will greatly contribute to our understanding of the divergence, variation, and function of small RNAs and may be a valuable resource in clarifying new regulatory mechanisms of cortical development. Identification and quantification of small RNA: forebrain and cortex from E10 to P28
2012-06-25 | E-GEOD-27576 | biostudies-arrayexpress
Project description:Using a crucifer-infecting strain of Tobacco Mosaic Virus (TMV-Cg) and Arabidopsis thaliana as a model system, we analyzed the viral small RNA profile in wild-type plants as well as rdr mutants by applying small RNA deep sequencing technology. Over 100,000 TMV-Cg-specific small RNA reads, mostly of 21- (78.4%) and 22-nucleotide (12.9%) in size and originating predominately (79.9%) from the genomic sense RNA strand, were captured at an early infection stage, yielding the first high-resolution small RNA map for a plant virus. The TMV-Cg genome harbored multiple, highly reproducible small RNA-generating hot spots that corresponded to regions with no apparent local hairpin-forming capacity. Significantly, both the rdr1 and rdr6 mutants exhibited globally reduced levels of viral small RNA production as well as reduced strand bias in viral small RNA population, revealing an important role for these host RDRs in viral siRNA biogenesis. In addition, an informatics analysis showed that a large set of host genes could be potentially targeted by TMV-Cg-derived siRNAs for posttranscriptional silencing, raising the interesting possibility for a hidden layer of widespread virus-host interactions that may contribute to viral pathogenicity and host specificity. Profiling of TMV-Cg derived small RNAs in systemically infected tissues of wild type (Col-0) Arabidopsis as well as the rdr1and rdr6 mutants, at 3 days post-infection.
2009-03-24 | E-GEOD-12918 | biostudies-arrayexpress