Whole exome sequencing in unexplained recurrent miscarriage families identified novel pathogenic genetic causes of euploid miscarriage.
Ontology highlight
ABSTRACT:
SUBMITTER: Wang X
PROVIDER: S-EPMC10152170 | biostudies-literature | 2023 May
REPOSITORIES: biostudies-literature
Publications
Whole exome sequencing in unexplained recurrent miscarriage families identified novel pathogenic genetic causes of euploid miscarriage.
Wang Xiyao X Shi Wenqiang W Zhao Shaotong S Gong Deshun D Li Shuo S Hu Cuiping C Chen Zi-Jiang ZJ Li Yan Y Yan Junhao J
Human reproduction (Oxford, England) 20230501 5
<h4>Study question</h4>Can whole exome sequencing (WES) followed by trio bioinformatics analysis identify novel pathogenic genetic causes of first trimester euploid miscarriage?<h4>Summary answer</h4>We identified genetic variants in six candidate genes that indicated plausible underlying causes of first-trimester euploid miscarriage.<h4>What is known already</h4>Previous studies have identified several monogenic causes of Mendelian inheritance in euploid miscarriages. However, most of these stu ...[more]
Similar Datasets
Project description:Intellectual disability (ID) is a condition of significant limitation of cognitive functioning and adaptive behavior, with 50% of etiology attributed to genetic predisposition. We recruited two consanguineous Pakistani families manifesting severe ID and developmental delay. The probands were subjected to whole exome sequencing (WES) and variants were further prioritized based on population frequency, predicted pathogenicity and functional relevance. The WES data analysis identified homozygous pathogenic variants in genes MBOAT7 and TRAPPC9. The pathogenicity of the variants was supported by co-segregation analysis and in silico tool. The findings of this study expand mutation spectrum and provide additional evidence to the role of MBOAT7 and TRAPPC9 in causation of ID.
| S-EPMC9858807 | biostudies-literature
Project description:BackgroundTreacher Collins syndrome (TCS, OMIM 154500) is an autosomal disorder of craniofacial development with an incidence rate of 1/50,000 live births. Although TCOF1, POLR1D, and POLR1C, have been identified as the pathogenic genes for about 90% TCS patients, the pathogenic variants of about 8-11% cases remain unknown. The object of this study is to describe the molecular basis of 14 clinically diagnosed TCS patients from four families using Whole-exome sequencing (WES) followed by Sanger sequencing confirmation, and to analyze the effect of bone conduction hearing rehabilitation in TCS patients with bilateral conductive hearing loss.ResultsFour previously unreported heterozygous pathogenic variants (c.3047-2A > G, c.2478 + 5G > A, c.489delC, c.648delC) were identified in the TCOF1 gene, one in each of the four families. Sanger sequencing in family members confirmed co-segregation of the identified TCOF1 variants with the phenotype. The mean pure-tone threshold improvements measured 3 months after hearing intervention were 28.8 dB for soft-band BAHA, 36.6 ± 2.0 dB for Ponto implantation, and 27.5 dB SPL for Bonebridge implantation. The mean speech discrimination improvements measured 3 months after hearing intervention in a sound field with a presentation level of 65 dB SPL were 44%, 51.25 ± 5.06, and 58%, respectively. All six patients undergoing hearing rehabilitation in this study got a satisfied hearing improvement.ConclusionsWES combined with Sanger sequencing enables the molecular diagnosis of TCS and may detect other unknown causative genes. Bone conduction hearing rehabilitation may be an optimal option for TCS patients with bilateral conductive hearing loss.
| S-EPMC6631538 | biostudies-literature
Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.
| S-EPMC9201170 | biostudies-literature
Project description:Recurrent miscarriages occur in about 5% of couples trying to conceive. In the past decade, the products of miscarriage have been studied using array comparative genomic hybridization (a-CGH). Within the last decade, an association has been proposed between miscarriages and single or multigenic changes, introducing the possibility of detecting other underlying genetic factors by whole exome sequencing (WES). We performed a-CGH on the products of miscarriage from 1625 Iranian women in consanguineous or non-consanguineous marriages. WES was carried out on DNA extracted from the products of miscarriage from 20 Iranian women in consanguineous marriages and with earlier normal genetic testing. Using a-CGH, a statistically significant difference was detected between the frequency of imbalances in related vs. unrelated couples (P < 0.001). WES positively identified relevant alterations in 11 genes in 65% of cases. In 45% of cases, we were able to classify these variants as pathogenic or likely pathogenic, according to the American College of Medical Genetics and Genomics guidelines, while in the remainder, the variants were classified as of unknown significance. To the best of our knowledge, our study is the first to employ WES on the products of miscarriage in consanguineous families with recurrent miscarriages regardless of the presence of fetal abnormalities. We propose that WES can be helpful in making a diagnosis of lethal disorders in consanguineous couples after prior genetic testing.
| S-EPMC7997959 | biostudies-literature
Project description:BackgroundIntellectual disability (ID) represents a neurodevelopmental disorder, which is characterized by marked defects in the intellectual function and adaptive behavior, with an onset during the developmental period. ID is mainly caused by genetic factors, and it is extremely genetically heterogeneous. This study aims to identify the genetic cause of ID using trio-WES analysis.MethodsWe recruited four pediatric patients with unexplained ID from non-consanguineous families, who presented at the Department of Pediatrics, Guizhou Provincial People's Hospital. Whole-exome sequencing (WES) and Sanger sequencing validation were performed in the patients and their unaffected parents. Furthermore, conservative analysis and protein structural and functional prediction were performed on the identified pathogenic variants.ResultsWe identified five novel de novo mutations from four known ID-causing genes in the four included patients, namely COL4A1 (c.2786T>A, p.V929D and c.2797G>A, p.G933S), TBR1 (c.1639_1640insCCCGCAGTCC, p.Y553Sfs*124), CHD7 (c.7013A>T, p.Q2338L), and TUBA1A (c.1350del, p.E450Dfs*34). These mutations were all predicted to be deleterious and were located at highly conserved domains that might affect the structure and function of these proteins.ConclusionOur findings contribute to expanding the mutational spectrum of ID-related genes and help to deepen the understanding of the genetic causes and heterogeneity of ID.
| S-EPMC9459325 | biostudies-literature
Project description:BackgroundGenome-wide sequencing may extensively identify potential pathogenic variants, which helps to understand mechanisms of tumorigenesis, but such study has not been reported in benzene-induced leukemia (BIL).MethodsWe recruited 10 BIL patients and conducted the whole-exome sequencing on their peripheral blood samples. The obtained sequencing data were screened for potential pathogenic and novel variants, then the variants-located genes were clustered to identify cancer-related pathways. Shared or recurrent variants among the BIL cases were also identified and evaluated for their potential functional impact.ResultsWe identified 48,802 variants in exons in total, 97.3% of which were single nucleotide variants. After filtering out variants with minor allele frequency ≥ 1%, we obtained 8667 potentially pathogenic variants, of which 174 were shared by all the BIL cases. The identified variants located in genes that could be significantly enriched into certain cancer-related pathways such as PI3K-AKT signaling pathway and Ras signaling pathway. We also identified 1010 novel variants with no record in the Genome Aggregation Database and in dbSNP, and one of them was shared by 90% cases. The recurrent and novel variant caused a missense mutation in SESN3.ConclusionsWe examined variations of the whole exome in BIL patients for the first time. The commonly shared variants implied a relation with BIL, and the recurrent and novel variant might be specifically related to BIL. The related variants may help unravel the carcinogenic mechanisms of BIL.
| S-EPMC9878782 | biostudies-literature
Project description:BackgroundEpilepsy is a group of neurological disorders characterized by recurrent epileptic seizures. Epilepsy is affected by many factors, approximately 20-30% of cases are caused by acquired conditions, but in the remaining cases, genetic factors play an important role. Early establishment of a specific diagnosis is important to treat and manage this disease.MethodsIn this study, we have recruited 43 epileptic encephalopathy patients and the molecular genetic analysis of those children was performed by whole-exome sequencing (WES).ResultsFourteen patients (32.6%, 14/43) had positive genetic diagnoses, including fifteen mutations in fourteen genes. The overall diagnostic yield was 32.6%. A total of 9 patients were diagnosed as pathogenic mutations, including 4 variants had been reported as pathogenic previously and 6 novel variants that had not been reported previously. Therefore, WES heralds promise as a tool for clinical diagnosis of patients with genetic disease.ConclusionEarly establishment of a specific diagnosis, on the one hand, is necessary for providing an accurate prognosis and recurrence risk as well as optimizing management and treatment options. On the other hand, to unveil the genetic architecture of epilepsy, it is of vital importance to investigate the phenotypic and genetic complexity of epilepsy.
| S-EPMC7720389 | biostudies-literature
Project description:Neuromuscular diseases (NMD) account for a significant proportion of infant and childhood mortality and devastating chronic disease. Determining the specific diagnosis of NMD is challenging due to thousands of unique or rare genetic variants that result in overlapping phenotypes. We present four unique childhood myopathy cases characterized by relatively mild muscle weakness, slowly progressing course, mildly elevated creatine phosphokinase (CPK), and contractures. We also present two additional cases characterized by severe prenatal/neonatal myopathy. Prior extensive genetic testing and histology of these cases did not reveal the genetic etiology of disease. Here, we applied whole exome sequencing (WES) and bioinformatics to identify likely causal pathogenic variants in each pedigree. In two cases, we identified novel pathogenic variants in COL6A3. In a third case, we identified novel likely pathogenic variants in COL6A6 and COL6A3. We identified a novel splice variant in EMD in a fourth case. Finally, we classify two cases as calcium channelopathies with identification of novel pathogenic variants in RYR1 and CACNA1S. These are the first cases of myopathies reported to be caused by variants in COL6A6 and CACNA1S. Our results demonstrate the utility and genetic diagnostic value of WES in the broad class of NMD phenotypes.
| S-EPMC4521965 | biostudies-literature
Project description:BackgroundHearing loss is the most common sensory defect, and it affects over 6% of the population worldwide. Approximately 50-60% of hearing loss patients are attributed to genetic causes. Currently, more than 100 genes have been reported to cause non-syndromic hearing loss. It is possible and efficient to screen all potential disease-causing genes for hereditary hearing loss by whole exome sequencing (WES).MethodsWe collected 5 consanguineous pedigrees from Pakistan with hearing loss and applied WES in selected patients for each pedigree, followed by bioinformatics analysis and Sanger validation to identify the causal genes.ResultsVariants in 7 genes were identified and validated in these pedigrees. We identified single candidate variant for 3 pedigrees: GIPC3 (c.937 T > C), LOXHD1 (c.6136G > A) and TMPRSS3 (c.941 T > C). The remaining 2 pedigrees each contained two candidate variants: TECTA (c.4045G > A) and MYO15A (c.3310G > T and c.9913G > C) for one pedigree and DFNB59 (c.494G > A) and TRIOBP (c.1952C > T) for the other pedigree. The candidate variants were validated in all available samples by Sanger sequencing.ConclusionThe candidate variants in hearing-loss genes were validated to be co-segregated in the pedigrees, and they may indicate the aetiologies of hearing loss in such patients. We also suggest that WES may be a suitable strategy for hearing-loss gene screening in clinical detection.
| S-EPMC7368710 | biostudies-literature
Project description:BackgroundCystic fibrosis (CF) is an autosomal recessive disease caused by genetic variants of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. It is a common hereditary disease in Caucasians while rare in the Chinese. Until now, only 87 Chinese patients have been reported with molecular confirmations. The variant spectrum and clinical features of Chinese CF patients are obviously different from those of Caucasians.Materials and methodsWhole-exome sequencing was applied to analyze the exome of three individuals who have only the typical CF phenotype in the respiratory system from two consanguineous families. The protein domain and structure analysis were applied to predict the impact of the variants. Sanger sequencing was applied to validate the candidate variants.ResultsA previously reported homozygous variant in CFTR (NM_000492.4: c.1000C > T, p.R334W) was identified in proband I. A novel homozygous variant in a polymorphic position (NM_000492.4: c.1409T > A, p.V470E) was identified in two individuals in the family II. The novel CFTR variant predicted to be disease-causing is the first, to the best of our knowledge, to be reported in CFTR. However, in vitro validation is still needed.ConclusionOur finding expands the variant spectrum of CFTR, reveals clearer clinical phenotype distinction and variant spectrum distinction between Chinese and Caucasian CF patients, and contributes to a more rapid genetic diagnosis and future genetic counseling.
| S-EPMC8283821 | biostudies-literature