Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families.
Ontology highlight
ABSTRACT:
SUBMITTER: Bao X
PROVIDER: S-EPMC10704694 | biostudies-literature | 2023 Dec
REPOSITORIES: biostudies-literature
Publications
Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families.
Bao Xiuqin X Qin Danqing D Wang Jicheng J Chen Jing J Yao Cuize C Liang Jie J Liang Kailing K Wang Yixia Y Wang Yousheng Y Du Li L Yin Aihua A
Human genomics 20231208 1
<h4>Background</h4>β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.<h4>Results</h4>In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β<sup>CD59</sup>) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β<sup>CD128-134</sup>) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. Howev ...[more]
Similar Datasets
Project description:OBJECTIVE:Mucolipidosis II and III alpha/beta (ML II & ML III alpha/beta) are rare autosomal recessive lysosomal storage disorders. ML II is clinically evident from birth with a progressive course and fatal outcome in childhood. The typical phenotypes of ML II include limited statural growth, craniofacial abnormality, skeletal malformation, intelligence developmental deficiency and visceral organ abnormality. ML III is milder than ML II. Mutations in GNPTAB cause the ML II/III. METHODS:Two families with ML II/III (initially undiagnosed) were recruited. We applied whole-exome sequencing (WES) and filtered mutations by genes causing lysosomal storage diseases with skeletal involvement. Mutational analysis and co-segregation confirmation were then performed. RESULTS:We presented two families with ML II or ML III alpha/beta. By WES, the compound heterozygosity of GNPTAB (c.2404C>T, p.Q802* and c.2590dup, p.E864Gfs*4) is identified in a family with ML II, and c.1364C>T, p.A455V and c.2715+1G>A are detected in a family with ML III alpha/beta. CONCLUSION:We detected the causative mutations in two ML II/III families by WES and confirmed their diagnosis of the diseases. The present identification of mutations expands the spectrum of known GNPTAB mutations and it may contribute to novel approaches to genetic diagnosis and counseling for patients with ML II/III.
| S-EPMC6949696 | biostudies-literature
Project description:Hereditary xerocytosis (HX) is a rare disorder caused by defects of RBC permeability, associated with haemolytic anaemia of variable degree and iron overload. It is sometimes misdiagnosed as hereditary spherocytosis or other congenital haemolytic anaemia. Splenectomy is contraindicated due to increased risk of thromboembolic complications. We report the clinical, haematological, and molecular characteristics of four patients from two unrelated Italian families affected by HX, associated with beta-thalassemia trait and heterozygous pyruvate kinase deficiency, respectively. Two patients had been splenectomised and displayed thrombotic episodes. All patients had iron overload in the absence of transfusion, two of them requiring iron chelation. The diagnosis of HX was confirmed by LoRRca Osmoscan analysis showing a left-shifted curve. PIEZO1 gene sequencing revealed the presence of mutation p.E2496ELE, showing that this is one of the most frequent mutations in this disease. The concomitant defects did not aggravate the clinical phenotype; however, in one patient, the initial diagnosis of pyruvate kinase deficiency delayed the correct diagnosis of HX for many years and resulted in splenectomy followed by thrombotic complications. The study underlines the importance of a precise diagnosis in HX, particularly in view of splenectomy, and the need of a molecular confirmation of suspected RBC enzymopathy.
| S-EPMC5358460 | biostudies-literature
Project description:AimTo describe the clinical heterogeneity of patients with novel mutations in BEST1.MethodsAll the members in the two Chinese families underwent detailed clinical evaluations including best-corrected visual acuity, slit-lamp examination, applanation tonometry, and dilated fundus examination. Fundus autofluorescence, fundus fluorescein angiography, spectral-domain optical coherence tomography, electrooculography, and electroretinogram were also performed. Genomic DNA was extracted from venous blood for all the participants. The targeted next-generation sequencing of inherited retinal disease-associated genes was conducted to identify the causative mutation.ResultsA novel BEST1 missense mutation c.41T>C (p.Leu14Ser) was identified in Family 1. It was co-segregated with the phenotype of best vitelliform macular dystrophy (BVMD) and bioinformatics analysis confirmed it was harmful. Another novel BEST1 frameshift mutation c.345_346insGGCAAGGACG (p.Glu119Glyfs*116) and a novel USH2A missense mutation c.12560G>A, p.Arg4187His were identified in family 2 with retinitis pigmentosa (RP), which might interact and lead to the phenotype of RP.ConclusionTwo novel mutations in the BEST1 gene in two unrelated families with distinct phenotypes and BEST1 mutation accompanied with USH2A mutation would result in RP, which could be enormously helpful in understanding the pathogenesis of the inherited retinal disease caused by a BEST1 mutation.
| S-EPMC8818453 | biostudies-literature
Project description:BackgroundSyndactyly type 1 (SD1) is an autosomal dominant limb malformation characterized in its classical form by complete or partial webbing between the third and fourth fingers and/or the second and third toes. Its four subtypes (a, b, c, and d) are defined based on variable phenotypes, but the responsible gene is yet to be identified. SD1-a has been mapped to chromosome 3p21.31 and SD1-b to 2q34-q36. SD1-c and SD1-d are very rare and, to our knowledge, no gene loci have been identified.Methods and resultsIn two Chinese families with SD1-c, linkage and haplotype analyses mapped the disease locus to 2q31-2q32. Copy number variation (CNV) analysis, using array-based comparative genomic hybridization (array CGH), excluded the possibility of microdeletion or microduplication. Sequence analyses of related syndactyly genes in this region identified c.917G>A (p.R306Q) in the homeodomain of HOXD13 in family A. Analysis on family B identified the mutation c.916C>G (p.R306G) and therefore confirmed the genetic homogeneity. Luciferase assays indicated that these two mutations affected the transcriptional activation ability of HOXD13. The spectrum of HOXD13 mutations suggested a close genotype-phenotype correlation between the different types of HOXD13-Syndactyly. Overlaps of the various phenotypes were found both among and within families carrying the HOXD13 mutation.ConclusionsMutations (p.R306Q and p.R306G) in the homeodomain of HOXD13 cause SD1-c. There are affinities between SD1-c and synpolydactyly. Different limb malformations due to distinct classes of HOXD13 mutations should be considered as a continuum of phenotypes and further classification of syndactyly should be done based on phenotype and genotype.
| S-EPMC4006867 | biostudies-literature
Project description:BackgroundReactivation of fetal hemoglobin (HbF, α2γ2) holds a therapeutic target for β-thalassemia and sickle cell disease. Although many HbF regulators have been identified, the methylation patterns in β-globin cluster driving the fetal-to-adult hemoglobin switch remains to be determined.ResultsHere, we evaluated DNA methylation patterns of the β-globin cluster from peripheral bloods of 105 β0/β0 thalassemia patients and 44 normal controls. We also recruited 15 bone marrows and 4 cord blood samples for further evaluation. We identified that the CpG sites in the locus control region (LCR) DNase I hypersensitive site 4 and 3 (HS4-3) regions, and γ- and β-globin promoters displayed hypomethylation in β0/β0-thalassemia patients, especially for the patients with high HbF level, as compared with normal controls. Furthermore, hypomethylations in most of CpG sites of the HS4-3 core regions were also observed in bone marrows (BM) of β0/β0-patients compared with normal controls; and methylation level of γ-globin promoter -50 and + 17 CpG sites showed lower methylation level in patients with high HbF level compared with those with low HbF level and a negative correlation with HbF level among β0-thalassemia patients. Finally, γ-globin promoter + 17 and + 50 CpG sites also displayed significant hypomethylation in cord blood (CB) tissues compared with BM tissues from normal controls.ConclusionsOur findings revealed methylation patterns in β-globin cluster associated with β0 thalassemia disease and γ-globin expression, contributed to understand the epigenetic modification in β0 thalassemia patients and provided candidate targets for the therapies of β-hemoglobinopathies.
| S-EPMC7712619 | biostudies-literature
Project description:BackgroundThalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of β-thalassemia caused by five different mutations in the globin gene.MethodsNext-generation sequencing (NGS) was used to identify novel α- and β-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis.ResultsNGS revealed five novel cases of α- and β-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed.ConclusionFive novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.
| S-EPMC8683637 | biostudies-literature
Project description:Single nucleotide polymorphisms are informative for haplotype analysis associated with genetic background and clinical linkage studies of β-thalassemia mutations. Hence, the aim of this study was to investigate five polymorphisms (codon 2 (C/T), IVS II-16 (C/G), IVS II-74 (G/T), IVS II-81 (C/T) and the Hinf I (T/A) polymorphism) on the β-globin gene, related to eight common β-thalassemia mutations in Thailand, including NT-28 (A > G), codon 17 (A > T), codon 19 (A > G), HbE (G > A), IVS I-1 (G > C), IVS I-5 (G > C), codon 41/42 (-TTCT) and IVS II-654 (C > T). The strongest LD (100%) between the β-thalassemia mutation allele and all five SNPs was found in NT-28 (A > G), codon 17 (A > T) and codon 19 (A > G). In the haplotype analysis, we found three haplotypes (H1, H2 and H7) related to Hb E, whereas we only found two haplotypes related to codon 41/42 (-TTCT) (H1, H3) and IVS I-1 (G > C) (H3, H4). Of interest is the finding relating to a single haplotype in the remaining β-thalassemia mutations. Furthermore, phylogenetic tree analysis revealed three clusters of these common β-thalassemia mutations in the Thai population and enabled us to determine the origin of these mutations. Here, we present the results of our study, including four intragenic polymorphisms and the finding that the Hinf I polymorphism could be informative in genetic background analysis, population studies and for predicting the severity of β-thalassemia in Thailand.
| S-EPMC9407504 | biostudies-literature
Project description:BackgroundCongenital cataract, a kind of cataract presenting at birth or during early childhood, is a leading cause of childhood blindness. To date, more than 30 genes on different chromosomes are known to cause this disorder. This study aimed to identify the HSF4 mutations in a cohort from Chinese families affected with congenital cataracts.MethodsForty-two unrelated non-syndromic congenital cataract families and 112 ethnically matched controls from southeast China were recruited from the southeast of China. We employed Sanger sequencing method to discover the variants. To confirm the novel mutations, STR haplotypes were constructed to check the co-segregation with congenital cataract. The pathogenic potential of the novel mutations were assessed using bioinformatics tools including SIFT, Polyphen2, and Human Splicing Finder. The pathogenicity of all the mutations was evaluated by the guidelines of American College of Medical Genetics and InterVar software.ResultsNo previously reported HSF4 mutations were found in all the congenital cataract families. Five novel HSF4 mutations including c.187 T > C (p.Phe63Leu), c.218G > T (p.Arg73Leu), c.233A > G (p.Tyr78Cys), IVS5 c.233-1G > A and c.314G > C (p.Ser105Thr) were identified in five unrelated families with congenital cataracts, respectively. These mutations co-segregated with all affected individuals in each family were not observed in the unaffected family members or in 112 unrelated controls. All five mutations were categorized to be the disease "pathogenic" according to ACMG guidelines and using InterVar software. Mutations in the HSF4 were responsible for 11.90% Chinese families with congenital cataracts in our cohort.ConclusionsIn the study, we identified five novel HSF4 mutations in Chinese families with congenital cataracts. Our results expand the spectrum of HSF4 mutations causing congenital cataracts, which may be helpful for the molecular diagnosis of congenital cataracts in the era of precision medicine.
| S-EPMC6109319 | biostudies-literature
Project description:A primary challenge in lentiviral gene therapy of β-hemoglobinopathies is to maintain low vector copy numbers to avoid genotoxicity while being reliably therapeutic for all genotypes. We designed a high-titer lentiviral vector, LVβ-shα2, that allows coordinated expression of the therapeutic βA-T87Q-globin gene and of an intron-embedded miR-30-based short hairpin RNA (shRNA) selectively targeting the α2-globin mRNA. Our approach was guided by the knowledge that moderate reduction of α-globin chain synthesis ameliorates disease severity in β-thalassemia. We demonstrate that LVβ-shα2 reduces α2-globin mRNA expression in erythroid cells while keeping α1-globin mRNA levels unchanged and βA-T87Q-globin gene expression identical to the parent vector. Compared with the first βA-T87Q-globin lentiviral vector that has received conditional marketing authorization, BB305, LVβ-shα2 shows 1.7-fold greater potency to improve α/β ratios. It may thus result in greater therapeutic efficacy and reliability for the most severe types of β-thalassemia and provide an improved benefit/risk ratio regardless of the β-thalassemia genotype.
| S-EPMC8417505 | biostudies-literature
Project description:β-thalassemia, an autosomal recessive blood disorder that reduces the production of hemoglobin, is majorly caused by the point mutation of the HBB gene resulting in reduced or absent β-globin chains of the hemoglobin tetramer. Animal models recapitulating both the phenotype and genotype of human disease are valuable in the exploration of pathophysiology and for in vivo evaluation of novel therapeutic treatments. The docile temperament, short vital cycles, and low cost of rabbits make them an attractive animal model. However, β-thalassemia rabbit models are currently unavailable. Here, using CRISPR/Cas9-mediated genome editing, we point mutated the rabbit β-globin gene HBB2 with high efficiency and generated a β-thalassemia rabbit model. Hematological and histological analyses demonstrated that the genotypic mosaic F0 displayed a mild phenotype of anemia, and the heterozygous F1 exhibited typical characteristics of β-thalassemia. Whole-blood transcriptome analysis revealed that the gene expression was altered in HBB2-targeted when compared with WT rabbits. And the highly expressed genes in HBB2-targeted rabbits were enriched in lipid and iron metabolism, innate immunity, and hematopoietic processes. In conclusion, using CRISPR-mediated HBB2 knockout, we have created a β-thalassemia rabbit model that accurately recapitulates the human disease phenotype. We believe this tool will be valuable in advancing the investigation of pathogenesis and novel therapeutic targets of β-thalassemia and associated complications.
| S-EPMC8024976 | biostudies-literature