Browse
Submit Data
Databases
API
Help

Dataset Information

35 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Unbiased selection of localization elements reveals cis-acting determinants of mRNA bud localization in Saccharomyces cerevisiae.

ABSTRACT: Cytoplasmic mRNA localization is a mechanism used by many organisms to generate asymmetry and sequester protein activity. In the yeast Saccharomyces cerevisiae, mRNA transport to bud tips of dividing cells is mediated by the binding of She2p, She3p, and Myo4p to coding regions of the RNA. To date, 24 bud-localized mRNAs have been identified, yet the RNA determinants that mediate localization remain poorly understood. Here, we used nonhomologous random recombination to generate libraries of sequences that could be selected for their ability to bind She-complex proteins, thereby providing an unbiased approach for minimizing and mapping localization elements in several transported RNAs. Analysis of the derived sequences and predicted secondary structures revealed short sequence motifs that mediate binding to the She complex and RNA localization to the bud tip in vivo. A predicted single-stranded core CG dinucleotide appears to be an important component of the RNA-protein interface, although other nucleotides contribute in a context-dependent manner. Our findings further our understanding of RNA recognition by the She complex, and the methods used here should be applicable for elucidating minimal RNA motifs involved in many other types of interactions.

SUBMITTER: Jambhekar A

PROVIDER: S-EPMC1298916 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Vasopressin mRNA localization in nerve cells: characterization of cis-acting elements and trans-acting factors.

Project description:mRNA localization is a complex pathway. Besides mRNA sorting per se, this process includes aspects of regulated translation. It requires protein factors that interact with defined sequences (or sequence motifs) of the transcript, and the protein/RNA complexes are finally guided along the cytoskeleton to their ultimate destinations. The mRNA encoding the vasopressin (VP) precursor protein is localized to the nerve cell processes in vivo and in primary cultured nerve cells. Sorting of VP transcripts to dendrites is mediated by the last 395 nucleotides of the mRNA, the dendritic localizer sequence, and it depends on intact microtubules. In vitro interaction studies with cytosolic extracts demonstrated specific binding of a protein, enriched in nerve cell tissues, to the radiolabeled dendritic localizer sequence probe. Biochemical purification revealed that this protein is the multifunctional poly(A)-binding protein (PABP). It is well known for its ability to bind with high affinity to poly(A) tails of mRNAs, prerequisite for mRNA stabilization and stimulation of translational initiation, respectively. With lower affinities, PABP can also associate with non-poly(A) sequences. The physiological consequences of these PABP/RNA interactions are far from clear but may include functions such as translational silencing. Presumably, the translational state of mRNAs subject to dendritic sorting is influenced by external stimuli. PABP thus could be a component required to regulate local synthesis of the VP precursor and possibly of other proteins.

| S-EPMC34625 | biostudies-literature

Dissecting the cis and trans elements that regulate adjacent-gene coregulation in Saccharomyces cerevisiae.

Project description:The relative positions that genes occupy on their respective chromosomes can play a critical role in determining how they are regulated at the transcriptional level. For example, a significant fraction of the genes from a variety of coregulated gene sets, including the ribosomal protein (RP) and the rRNA and ribosome biogenesis (RRB) regulons, exist as immediate, adjacent gene pairs. These gene pairs occur in all possible divergent, tandem, and convergent orientations. Adjacent-gene pairing in these regulons is associated with a tighter transcriptional coregulation than is observed for nonpaired genes of the same regulons. In order to define the cis and trans factors that regulate adjacent-gene coregulation (AGC), we conducted a mutational analysis of the convergently oriented RRB gene pair MPP10-YJR003C. We observed that coupled corepression of the gene pair under heat shock was abrogated when the two genes were separated by an actively expressed RNA polymerase (Pol) II transcription unit (the LEU2 gene) but not when the inserted LEU2 gene was repressed. In contrast, the insertion of an RNA Pol III-transcribed tRNA (Thr) gene did not disrupt the coregulated repression of MPP10 and YJR003C. A targeted screen of mutants defective in regulating chromosome architecture revealed that the Spt20, Snf2, and Chd1 proteins were required for coupling the repression of YJR003C to that of MPP10. Nucleosome occupancy assays performed across the MPP10 and YJR003C promoter regions revealed that the mechanism of corepression of the gene pair was not related to the repositioning of nucleosomes across the respective gene promoters.

| S-EPMC4054278 | biostudies-literature

Cis- and trans-acting elements determining induction of the genes of the gamma-aminobutyrate (GABA) utilization pathway in Saccharomyces cerevisiae.

Project description:In S. cerevisiae, gamma-aminobutyrate (GABA) induces transcription of the UGA genes required for its utilization as a nitrogen source. Analysis of the 5' region of the UGA1 and UGA4 genes led to the identification of a conserved GC-rich sequence (UASGABA) essential to induction by gamma-aminobutyrate. Alone, this UASGABA element also supported some levels of reporter gene transcription in the presence of gamma-aminobutyrate. To be effective, UASGABA requires two positive-acting proteins that both contain a Cys6-Zn2 type zinc-finger motif, namely pathway-specific Uga3p and pleiotropic Uga35p(Dal81p/DurLp). Further analysis of the UGA4 gene revealed that Gln3p, a global nitrogen regulatory protein containing a GATA zinc-finger domain, is required in order to reach high levels of gamma-aminobutyrate-induced transcription. The Gln3p factor exerts its function mainly through a cluster of 5'-GAT(A/T)A-3'(UASGATA) situated just upstream from UASGABA. The role of Gln3p is less predominant in UGA1 than in UGA4 gene expression. We propose that tight coupling between the UASGABA and UASGATA elements enables the cell to integrate, according to its nitrogen status, the induced expression levels of UGA4.

| S-EPMC306719 | biostudies-other

Identification of cis- and trans-acting elements involved in the expression of cold shock-inducible TIP1 gene of yeast Saccharomyces cerevisiae.

Project description:Northern blot hybridization analysis of a series of 5' end, 3' end and internal deletions has revealed that at least four different regions are involved in the regulation of the expression of TIP1, a cold shock-inducible gene of Saccharomyces cerevisiae. One of these four regions has negative effect on the expression of the TIP1 gene, while the others are responsible for the activation and cold shock-induction of the gene. A fragment involved in the cold-shock induction of TIP1 was used as a probe in gel retardation assays to identify the cold shock-factor. The cold shock-factor could be detected in cells grown at 30 degrees C as well as 10 degrees C, but both the amount of the factor and its affinity to DNA were found to increase 2-3-fold after cold shock. In addition, another factor was found to bind just upstream of the cold shock element, in a region where a transcriptional activator was predicted to function by Northern blot hybridization analysis. The amount of this activating factor and its affinity for DNA was not affected by temperature. Implications of our data on possible mechanisms of transcriptional regulation of the TIP1 gene by cold shock are discussed.

| S-EPMC307844 | biostudies-other

Role of the septin ring in the asymmetric localization of proteins at the mother-bud neck in Saccharomyces cerevisiae.

Project description:In the yeast Saccharomyces cerevisiae, septins form a scaffold in the shape of a ring at the future budding site that rearranges into a collar at the mother-bud neck. Many proteins bind asymmetrically to the septin collar. We found that the protein Bni4-CFP was located on the exterior of the septin ring before budding and on the mother side of the collar after budding, whereas the protein kinase Kcc4-YFP was located on the interior of the septin ring before budding and moved into the bud during the formation of the septin collar. Unbudded cells treated with the actin inhibitor latrunculin-A assembled cortical caps of septins on which Bni4-CFP and Kcc4-YFP colocalized. Bni4-CFP and Kcc4-YFP also colocalized on cortical caps of septins found in strains deleted for the genes encoding the GTPase activating proteins of Cdc42 (RGA1, RGA2, and BEM3). However, Bni4-CFP and Kcc4-YFP were still partially separated in mutants (gin4, elm1, cla4, and cdc3-1) in which septin morphology was severely disrupted in other ways. These observations provide clues to the mechanisms for the asymmetric localization of septin-associated proteins.

| S-EPMC1182288 | biostudies-literature

The RNA Structure of cis-acting Translational Elements of the Chloroplast psbC mRNA in Chlamydomonas reinhardtii.

Project description:Photosystem II is the first of two light-driven oxidoreductase complexes in oxygenic photosynthesis. The biogenesis of photosystem II requires the synthesis of polypeptide subunits encoded by the genomes in the chloroplast and the nucleus. In the chloroplast of the green alga Chlamydomonas reinhardtii, the synthesis of each subunit requires interactions between the 5' UTR of the mRNA encoding it and gene-specific translation factors. Here, we analyze the sequences and structures in the 5' UTR of the psbC mRNA, which are known to be required to promote translation and genetic interaction with TBC1, a nuclear gene required specifically for psbC translation. Results of enzymatic probing in vitro and chemical probing in vivo and in vitro support three secondary structures and reveal that one participates in a pseudoknot structure. Analyses of the effects of mutations affecting pseudoknot sequences, by structural mapping and thermal gradient gel electrophoresis, reveal that flexibility at the base of the major stem-loop is required for translation and higher order RNA conformation, and suggest that this conformation is stabilized by TBC1. This RNA pseudoknot tertiary structure is analogous to the internal ribosome entry sites that promote translation of certain viruses and cellular mRNAs in the nuclear-cytoplasmic systems of eukaryotes.

| S-EPMC4906055 | biostudies-literature

Identification of cis-acting elements and splicing factors involved in the regulation of BIM Pre-mRNA splicing.

Project description:Aberrant changes in the expression of the pro-apoptotic protein, BCL-2-like 11 (BIM), can result in either impaired or excessive apoptosis, which can contribute to tumorigenesis and degenerative disorders, respectively. Altering BIM pre-mRNA splicing is an attractive approach to modulate apoptosis because BIM activity is partly determined by the alternative splicing of exons 3 or 4, whereby exon 3-containing transcripts are not apoptotic. Here we identified several cis-acting elements and splicing factors involved in BIM alternative splicing, as a step to better understand the regulation of BIM expression. We analyzed a recently discovered 2,903-bp deletion polymorphism within BIM intron 2 that biased splicing towards exon 3, and which also impaired BIM-dependent apoptosis. We found that this region harbors multiple redundant cis-acting elements that repress exon 3 inclusion. Furthermore, we have isolated a 23-nt intronic splicing silencer at the 3' end of the deletion that is important for excluding exon 3. We also show that PTBP1 and hnRNP C repress exon 3 inclusion, and that downregulation of PTBP1 inhibited BIM-mediated apoptosis. Collectively, these findings start building our understanding of the cis-acting elements and splicing factors that regulate BIM alternative splicing, and also suggest potential approaches to alter BIM splicing for therapeutic purposes.

| S-EPMC3990581 | biostudies-literature

Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins.

Project description:Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

| S-EPMC1186718 | biostudies-literature

A new <i>cis</i>-acting motif is required for the axonal SMN-dependent Anxa2 mRNA localization.

Project description:Spinal muscular atrophy (SMA) is caused by mutations and/or deletions of the survival motor neuron gene (SMN1). Besides its function in the biogenesis of spliceosomal snRNPs, SMN might possess a motor neuron specific role and could function in the transport of axonal mRNAs and in the modulation of local protein translation. Accordingly, SMN colocalizes with axonal mRNAs of differentiated NSC-34 motor neuron-like cells. We recently showed that SMN depletion gives rise to a decrease in the axonal transport of the mRNAs encoding Annexin A2 (Anxa2). In this work, we have characterized the structural features of the Anxa2 mRNA required for its axonal targeting by SMN. We found that a G-rich motif located near the 3'UTR is essential for axonal localization of the Anxa2 transcript. We also show that mutations in the motif sequence abolish targeting of Anxa2 reporter mRNAs in axon-like structures of differentiated NSC-34 cells. Finally, localization of both wild-type and mutated Anxa2 reporters is restricted to the cell body in SMN-depleted cells. Altogether, our studies show that this G-motif represents a novel and essential determinant for axonal localization of the Anxa2 mRNA mediated by the SMN complex.

| S-EPMC5435863 | biostudies-literature

Coordinate action of distinct sequence elements localizes checkpoint kinase Hsl1 to the septin collar at the bud neck in Saccharomyces cerevisiae.

Project description:Passage through the eukaryotic cell cycle requires processes that are tightly regulated both spatially and temporally. Surveillance mechanisms (checkpoints) exert quality control and impose order on the timing and organization of downstream events by impeding cell cycle progression until the necessary components are available and undamaged and have acted in the proper sequence. In budding yeast, a checkpoint exists that does not allow timely execution of the G2/M transition unless and until a collar of septin filaments has properly assembled at the bud neck, which is the site where subsequent cytokinesis will occur. An essential component of this checkpoint is the large (1518-residue) protein kinase Hsl1, which localizes to the bud neck only if the septin collar has been correctly formed. Hsl1 reportedly interacts with particular septins; however, the precise molecular determinants in Hsl1 responsible for its recruitment to this cellular location during G2 have not been elucidated. We performed a comprehensive mutational dissection and accompanying image analysis to identify the sequence elements within Hsl1 responsible for its localization to the septins at the bud neck. Unexpectedly, we found that this targeting is multipartite. A segment of the central region of Hsl1 (residues 611-950), composed of two tandem, semiredundant but distinct septin-associating elements, is necessary and sufficient for binding to septin filaments both in vitro and in vivo. However, in addition to 611-950, efficient localization of Hsl1 to the septin collar in the cell obligatorily requires generalized targeting to the cytosolic face of the plasma membrane, a function normally provided by the C-terminal phosphatidylserine-binding KA1 domain (residues 1379-1518) in Hsl1 but that can be replaced by other, heterologous phosphatidylserine-binding sequences.

| S-EPMC4945140 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data