Dataset Information

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences.

ABSTRACT: We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.

SUBMITTER: Ramos-Gonzalez MI

PROVIDER: S-EPMC1317595 | biostudies-literature | 2006 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences.

Ramos-González María Isabel MI Campos María Jesús MJ Ramos Juan Luis JL Espinosa-Urgel Manuel M

Journal of bacteriology 20060101 1

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at dist ...[more]

PMID: 16352819

Similar Datasets

Project description:BACKGROUND: Mobile elements are involved in genomic rearrangements and virulence acquisition, and hence, are important elements in bacterial genome evolution. The insertion of some specific Insertion Sequences had been associated with repetitive extragenic palindromic (REP) elements. Considering that there are a sufficient number of available genomes with described REPs, and exploiting the advantage of the traceability of transposition events in genomes, we decided to exhaustively analyze the relationship between REP sequences and mobile elements. RESULTS: This global multigenome study highlights the importance of repetitive extragenic palindromic elements as target sequences for transposases. The study is based on the analysis of the DNA regions surrounding the 981 instances of Insertion Sequence elements with respect to the positioning of REP sequences in the 19 available annotated microbial genomes corresponding to species of bacteria with reported REP sequences. This analysis has allowed the detection of the specific insertion into REP sequences for ISPsy8 in Pseudomonas syringae DC3000, ISPa11 in P. aeruginosa PA01, ISPpu9 and ISPpu10 in P. putida KT2440, and ISRm22 and ISRm19 in Sinorhizobium meliloti 1021 genome. Preference for insertion in extragenic spaces with REP sequences has also been detected for ISPsy7 in P. syringae DC3000, ISRm5 in S. meliloti and ISNm1106 in Neisseria meningitidis MC58 and Z2491 genomes. Probably, the association with REP elements that we have detected analyzing genomes is only the tip of the iceberg, and this association could be even more frequent in natural isolates. CONCLUSION: Our findings characterize REP elements as hot spots for transposition and reinforce the relationship between REP sequences and genomic plasticity mediated by mobile elements. In addition, this study defines a subset of REP-recognizer transposases with high target selectivity that can be useful in the development of new tools for genome manipulation.

Project description:An Escherichia coli strain, ECOR28, was found to have insertions of an identical sequence (1,279 bp in length) at 10 loci in its genome. This insertion sequence (named IS621) has one large open reading frame encoding a putative protein that is 326 amino acids in length. A computer-aided homology search using the DNA sequence as the query revealed that IS621 was homologous to the piv genes, encoding pilin gene invertase (PIV). A homology search using the amino acid sequence of the putative protein encoded by IS621 as the query revealed that the protein also has partial homology to transposases encoded by the IS110/IS492 family elements, which were known to have partial homology to PIV. This indicates that IS621 belongs to the IS110/IS492 family but is most closely related to the piv genes. In fact, a phylogenetic tree constructed on the basis of amino acid sequences of PIV proteins and transposases revealed that IS621 belongs to the piv gene group, which is distinct from the IS110/IS492 family elements, which form several groups. PIV proteins and transposases encoded by the IS110/IS492 family elements, including IS621, have four acidic amino acid residues, which are conserved at positions in their N-terminal regions. These residues may constitute a tetrad D-E(or D)-D-D motif as the catalytic center. Interestingly, IS621 was inserted at specific sites within repetitive extragenic palindromic (REP) sequences at 10 loci in the ECOR28 genome. IS621 may not recognize the entire REP sequence in transposition, but it recognizes a 15-bp sequence conserved in the REP sequences around the target site. There are several elements belonging to the IS110/IS492 family that also transpose to specific sites in the repeated sequences, as does IS621. IS621 does not have terminal inverted repeats like most of the IS110/IS492 family elements. The terminal sequences of IS621 have homology with the 26-bp inverted repeat sequences of pilin gene inversion sites that are recognized and used for inversion of pilin genes by PIV. This suggests that IS621 initiates transposition through recognition of their terminal regions and cleavage at the ends by a mechanism similar to that used for PIV to promote inversion at the pilin gene inversion sites.

Dataset Information

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences.

Publications

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure