Dataset Information

Suppression of prion protein in livestock by RNA interference.

ABSTRACT: Given the difficulty of applying gene knockout technology to species other than mice, we decided to explore the utility of RNA interference (RNAi) in silencing the expression of genes in livestock. Short hairpin RNAs (shRNAs) were designed and screened for their ability to suppress the expression of caprine and bovine prion protein (PrP). Lentiviral vectors were used to deliver a transgene expressing GFP and an shRNA targeting PrP into goat fibroblasts. These cells were then used for nuclear transplantation to produce a cloned goat fetus, which was surgically recovered at 81 days of gestation and compared with an age-matched control derived by natural mating. All tissues examined in the cloned fetus expressed GFP, and PCR analysis confirmed the presence of the transgene encoding the PrP shRNA. Most relevant, Western blot analysis performed on brain tissues comparing the transgenic fetus with control demonstrated a significant (>90%) decrease in PrP expression levels. To confirm that similar methodologies could be applied to the bovine, recombinant virus was injected into the perivitelline space of bovine ova. After in vitro fertilization and culture, 76% of the blastocysts exhibited GFP expression, indicative that they expressed shRNAs targeting PrP. Our results provide strong evidence that the approach described here will be useful in producing transgenic livestock conferring potential disease resistance and provide an effective strategy for suppressing gene expression in a variety of large-animal models.

SUBMITTER: Golding MC

PROVIDER: S-EPMC1459347 | biostudies-literature | 2006 Apr

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Suppression of prion protein in livestock by RNA interference.

Golding Michael C MC Long Charles R CR Carmell Michelle A MA Hannon Gregory J GJ Westhusin Mark E ME

Proceedings of the National Academy of Sciences of the United States of America 20060327 14

Given the difficulty of applying gene knockout technology to species other than mice, we decided to explore the utility of RNA interference (RNAi) in silencing the expression of genes in livestock. Short hairpin RNAs (shRNAs) were designed and screened for their ability to suppress the expression of caprine and bovine prion protein (PrP). Lentiviral vectors were used to deliver a transgene expressing GFP and an shRNA targeting PrP into goat fibroblasts. These cells were then used for nuclear tra ...[more]

PMID: 16567624

Similar Datasets

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Dataset Information

Suppression of prion protein in livestock by RNA interference.

Publications

Suppression of prion protein in livestock by RNA interference.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets