Browse
Submit Data
Databases
API
Help

Dataset Information

26 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cis-cotranscription of two beta globin genes during chicken primitive hematopoiesis.

ABSTRACT: Chicken beta globin locus contains four genes, two of which, rho and epsilon, are expressed from the earliest stage of primitive hematopoiesis. Here we show that the transcription of these two genes in the nucleus engages in "on/off" phases. During each "on" phase, cotranscription of rho and epsilon in cis is favored. We propose that these two chicken beta globin genes are transcribed not by competing for a transcription initiation complex, but in a cooperative way.

SUBMITTER: Nagai H

PROVIDER: S-EPMC1934934 | biostudies-literature | 2007

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Cis-cotranscription of two beta globin genes during chicken primitive hematopoiesis.

Nagai Hiroki H Sheng Guojun G

PloS one 20070808 8

Chicken beta globin locus contains four genes, two of which, rho and epsilon, are expressed from the earliest stage of primitive hematopoiesis. Here we show that the transcription of these two genes in the nucleus engages in "on/off" phases. During each "on" phase, cotranscription of rho and epsilon in cis is favored. We propose that these two chicken beta globin genes are transcribed not by competing for a transcription initiation complex, but in a cooperative way. ...[more]

PMID: 17684550

Similar Datasets

Characterization of the chicken beta-globin insulator.

Project description:Insulators, first identified in Drosophila, are DNA sequence elements that shield a promoter from nearby regulatory elements. We have previously reported that a DNA sequence at the 5' end of the chicken beta-globin locus can function as an insulator. It is capable of shielding a reporter gene from the activating effects of a nearby mouse beta-globin locus control region element in the human erythroleukemic cell line K562. In this report, we show that most of the insulating activity lies in a 250-bp CpG island (core element), which contains the constitutive DNase I-hypersensitive site (5'HS4). DNA binding assays with the core sequence reveal a complex protein binding pattern. The insulating activity of the core element is multiplied when tandem copies are used. Although CpG islands are often associated with promoters of housekeeping genes, we find little evidence that the core element is a promoter. Furthermore, the insulator differs from a promoter in its ability to block the locus control region effect directionally.

| S-EPMC19555 | biostudies-literature

CpG hypomethylation in a large domain encompassing the embryonic beta-like globin genes in primitive erythrocytes.

Project description:There is little evidence addressing the role of CpG methylation in transcriptional control of genes that do not contain CpG islands. This is reflected in the ongoing debate about whether CpG methylation merely suppresses retroelements or if it also plays a role in developmental and tissue-specific gene regulation. The genes of the beta-globin locus are an important model of mammalian developmental gene regulation and do not contain CpG islands. We have analyzed the methylation status of regions in the murine beta-like globin locus in uncultured primitive and definitive erythroblasts and other cultured primary and transformed cell types. A large ( approximately 20-kb) domain is hypomethylated only in primitive erythroid cells; it extends from the region just past the locus control region to before beta-major and encompasses the embryonic genes Ey, beta h1, and beta h0. Even retrotransposons in this region are hypomethylated in primitive erythroid cells. The existence of this large developmentally regulated domain of hypomethylation supports a mechanistic role for DNA methylation in developmental regulation of globin genes.

| S-EPMC1951500 | biostudies-literature

Protection against telomeric position effects by the chicken cHS4 beta-globin insulator.

Project description:Epigenetic silencing of genes relocated near telomeres, termed telomeric position effect, has been extensively studied in yeast and more recently in vertebrates. However, protection of a transgene against telomeric position effects by chromatin insulators has not yet been addressed. In this work we investigated the capacity of the chicken beta-globin insulator cHS4 to shield a transgene against silencing by telomeric heterochromatin. Using telomeric repeats, we targeted transgene integration into telomeres of the chicken cell line HD3. When the chicken cHS4 insulator is incorporated to the transgene, we observe a sustained gene expression of single-copy integrants that can be maintained for >100 days of continuous culture. However, uninsulated single-copy clones showed an accelerated gene expression extinction profile. Unexpectedly, telomeric silencing was not reversed with trichostatin A or nicotidamine. In contrast, significant reactivation was obtained with 5-aza-2'-deoxycytidine, consistent with the subtelomeric DNA methylation status. Strikingly, insulated transgenes integrated into telomeric regions were enriched in histone methylation, such as H3K4me2 and H3K79me2, but not in histone acetylation. Furthermore, the cHS4 insulator counteracts telomeric position effects in an upstream stimulatory factor-independent manner. Our results suggest that this insulator has the capacity to adapt to different chromatin propagation signals in distinct insertional epigenome environments.

| S-EPMC1955792 | biostudies-literature

Smyd5 plays pivotal roles in both primitive and definitive hematopoiesis during zebrafish embryogenesis.

Project description:Methylation of histone tails plays a pivotal role in the regulation of a wide range of biological processes. SET and MYND domain-containing protein (SMYD) is a methyltransferase, five family members of which have been identified in humans. SMYD1, SMYD2, SMYD3, and SMYD4 have been found to play critical roles in carcinogenesis and/or the development of heart and skeletal muscle. However, the physiological functions of SMYD5 remain unknown. To investigate the function of Smyd5 in vivo, zebrafish were utilised as a model system. We first examined smyd5 expression patterns in developing zebrafish embryos. Smyd5 transcripts were abundantly expressed at early developmental stages and then gradually decreased. Smyd5 was expressed in all adult tissues examined. Loss-of-function analysis of Smyd5 was then performed in zebrafish embryos using smyd5 morpholino oligonucleotide (MO). Embryos injected with smyd5-MO showed normal gross morphological development, including of heart and skeletal muscle. However, increased expression of both primitive and definitive hematopoietic markers, including pu.1, mpx, l-plastin, and cmyb, were observed. These phenotypes of smyd5-MO zebrafish embryos were also observed when we introduced mutations in smyd5 gene with the CRISPR/Cas9 system. As the expression of myeloid markers was elevated in smyd5 loss-of-function zebrafish, we propose that Smyd5 plays critical roles in hematopoiesis.

| S-EPMC4932602 | biostudies-literature

Zebrafinch Blood Proteome - BetaA, the major beta globin in definitive red blood cells, is present from the onset of primitive erythropoiesis in chicken

Project description:Not available

2010-04-29 | PRD000099 | Pride

Structural and functional conservation at the boundaries of the chicken beta-globin domain.

Project description:We show that the 3' boundary of the chicken beta-globin locus bears striking structural similarities to the 5' boundary. In erythroid cells a clear transition in DNase I sensitivity of chromatin at the 3' end of the locus is observed, the location of this transition is marked by a constitutive DNase I hypersensitive site (HS), and DNA spanning this site has the enhancer-blocking capacity of an insulator. This HS contains a binding site for the transcription factor CTCF. As in the case of the 5' insulator, the CTCF site is both necessary and sufficient for the enhancer-blocking activity of the 3' boundary. The position of this insulator is consistent with our proposal that it may function to maintain the distinct regulatory programs of the globin genes and their closely appended 3' neighbor, an odorant receptor gene. We conclude that both boundaries of the chicken beta-globin domain are capable of playing functionally similar roles and that the same protein is a necessary component of the molecular mechanism through which these boundaries are defined.

| S-EPMC384375 | biostudies-literature

Drl.3 governs primitive hematopoiesis in zebrafish.

Project description:The molecular program controlling hematopoietic differentiation is not fully understood. Here, we describe a family of zebrafish genes that includes a novel hematopoietic regulator, draculin-like 3 (drl.3). We found that drl.3 is expressed in mesoderm-derived hematopoietic cells and is retained during erythroid maturation. Moreover, drl.3 expression correlated with erythroid development in gata1a- and spi1b-depleted embryos. Loss-of-function analysis indicated that drl.3 plays an essential role in primitive erythropoiesis and, to a lesser extent, myelopoiesis that is independent of effects on vasculature, emergence of primitive and definitive progenitor cells and cell viability. While drl.3 depletion reduced gata1a expression and inhibited erythroid development, enforced expression of gata1a was not sufficient to rescue erythropoiesis, indicating that the regulation of hematopoiesis by drl.3 extends beyond control of gata1a expression. Knockdown of drl.3 increased the proportion of less differentiated, primitive hematopoietic cells without affecting proliferation, establishing drl.3 as an important regulator of primitive hematopoietic cell differentiation.

| S-EPMC4107348 | biostudies-literature

Transcriptional interference among the murine beta-like globin genes.

Project description:Mammalian beta-globin loci contain multiple genes that are activated at different developmental stages. Studies have suggested that the transcription of one gene in a locus can influence the expression of the other locus genes. The prevalent model to explain this transcriptional interference is that all potentially active genes compete for locus control region (LCR) activity. To investigate the influence of transcription by the murine embryonic genes on transcription of the other beta-like genes, we generated mice with deletions of the promoter regions of Ey and betah1 and measured transcription of the remaining genes. Deletion of the Ey and betah1 promoters increased transcription of betamajor and betaminor 2-fold to 3-fold during primitive erythropoiesis. Deletion of Ey did not affect betah1 nor did deletion of betah1 affect Ey, but Ey deletion uniquely activated transcription from betah0, a beta-like globin gene immediately downstream of Ey. Protein analysis showed that betah0 encodes a translatable beta-like globin protein that can pair with alpha globin. The lack of transcriptional interference between Ey and betah1 and the gene-specific repression of betah0 did not support LCR competition among the embryonic genes and suggested that direct transcriptional interference from Ey suppressed betah0.

| S-EPMC1801066 | biostudies-literature

Insulation of the chicken beta-globin chromosomal domain from a chromatin-condensing protein, MENT.

Project description:Active genes are insulated from developmentally regulated chromatin condensation in terminally differentiated cells. We mapped the topography of a terminal stage-specific chromatin-condensing protein, MENT, across the active chicken beta-globin domain. We observed two sharp transitions of MENT concentration coinciding with the beta-globin boundary elements. The MENT distribution profile was opposite to that of acetylated core histones but correlated with that of histone H3 dimethylated at lysine 9 (H3me2K9). Ectopic MENT expression in NIH 3T3 cells caused a large-scale and specific remodeling of chromatin marked by H3me2K9. MENT colocalized with H3me2K9 both in chicken erythrocytes and NIH 3T3 cells. Mutational analysis of MENT and experiments with deacetylase inhibitors revealed the essential role of the reaction center loop domain and an inhibitory affect of histone hyperacetylation on the MENT-induced chromatin remodeling in vivo. In vitro, the elimination of the histone H3 N-terminal peptide containing lysine 9 by trypsin blocked chromatin self-association by MENT, while reconstitution with dimethylated but not acetylated N-terminal domain of histone H3 specifically restored chromatin self-association by MENT. We suggest that histone H3 modification at lysine 9 directly regulates chromatin condensation by recruiting MENT to chromatin in a fashion that is spatially constrained from active genes by gene boundary elements and histone hyperacetylation.

| S-EPMC193700 | biostudies-literature

Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families.

Project description:β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

| S-EPMC10704694 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data