Browse
Submit Data
Databases
API
Help

Dataset Information

32 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements.

ABSTRACT: Monoamine oxidases (MAO-A and MAO-B) have a key role in the degradation of amine neurotransmitters, such as dopamine, norepinephrine and serotonin. We identified an inherited 240 kb deletion on Xp11.3-p11.4, which encompasses both monoamine oxidase genes but, unlike other published reports, does not affect the adjacent Norrie disease gene (NDP). The brothers who inherited the deletion, and thus have no monoamine oxidase function, presented with severe developmental delay, intermittent hypotonia and stereotypical hand movements. The clinical features accord with published reports of larger microdeletions and selective MAO-A and MAO-B deficiencies in humans and mouse models and suggest considerable functional compensation between MAO-A and MAO-B under normal conditions.

SUBMITTER: Whibley A

PROVIDER: S-EPMC2987451 | biostudies-literature | 2010 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements.

Whibley Annabel A Urquhart Jill J Dore Jonathan J Willatt Lionel L Parkin Georgina G Gaunt Lorraine L Black Graeme G Donnai Dian D Raymond F Lucy FL

European journal of human genetics : EJHG 20100519 10

Monoamine oxidases (MAO-A and MAO-B) have a key role in the degradation of amine neurotransmitters, such as dopamine, norepinephrine and serotonin. We identified an inherited 240 kb deletion on Xp11.3-p11.4, which encompasses both monoamine oxidase genes but, unlike other published reports, does not affect the adjacent Norrie disease gene (NDP). The brothers who inherited the deletion, and thus have no monoamine oxidase function, presented with severe developmental delay, intermittent hypotonia ...[more]

PMID: 20485326

Similar Datasets

Biallelic in-frame deletion of SOX4 is associated with developmental delay, hypotonia and intellectual disability.

Project description:Intellectual disability (ID) represents an extremely heterogeneous group of disorders, characterized by significant limitations in intellectual function and adaptive behavior. Among the monogenic causes, autosomal recessive genes (ARID) are responsible for more than 50% of ID. Here, we report a novel in-frame homozygous deletion variant [c.730_753del; p.(Ala244_Gly251del)] in SOX4 (sex-determining region Y-related high-mobility group box 4), segregating with moderate to severe ID, hypotonia, and developmental delay in a Pakistani family. Our identified variant p.(Ala244_Gly251del) is predicted to remove evolutionarily conserved residues from the interdomain region and may destabilize the protein secondary structure. SOX4 belongs to group C of the SOX transcription regulating family known to be involved in early embryo development. Single-cell RNA data analysis of developing telencephalon revealed highly overlapping expression of SOX4 with SOX11 and DCX, known neurogenesis regulators. Our study expands the mutational landscape of SOX4 and the repertoire of the known genetic causes of ARID.

| S-EPMC8821644 | biostudies-literature

Variants in DOCK3 cause developmental delay and hypotonia.

Project description:The DOCK3 gene encodes the Dedicator of cytokinesis 3 (DOCK3) protein, which belongs to the family of guanine nucleotide exchange factors and is expressed almost exclusively in the brain and spinal cord. We used whole exome sequencing (WES) to investigate the molecular cause of developmental delay and hypotonia in three unrelated probands. WES identified truncating and splice site variants in Patient 1 and compound heterozygous and homozygous missense variants in Patients 2 and 3, respectively. We studied the effect of the three missense variants in vitro by using site-directed mutagenesis and pull-down assay and show that the induction of Rac1 activation was significantly lower in DOCK3 mutant cells compared with wild type human DOCK3 (P < 0.05). We generated a protein model to further examine the effect of the two missense variants within or adjacent to the DHR-2 domain in DOCK3 and this model supports pathogenicity. Our results support a loss of function mechanism but the data on the patients with missense variants should be cautiously interpreted because of the variability of the phenotypes and limited number of cases. Prior studies have described DOCK3 bi-allelic loss of function variants in two families with ataxia, hypotonia, and developmental delay. Here, we report on three patients with DOCK3-related developmental delay, wide-based or uncoordinated gait, and hypotonia, further supporting DOCK3's role in a neurodevelopmental syndrome and expanding the spectrum of phenotypic and genotypic variability.

| S-EPMC6777627 | biostudies-literature

De novo mutations in PURA are associated with hypotonia and developmental delay.

Project description:PURA is the leading candidate gene responsible for the developmental phenotype in the 5q31.3 microdeletion syndrome. De novo mutations in PURA were recently reported in 15 individuals with developmental features similar to the 5q31.3 microdeletion syndrome. Here we describe six unrelated children who were identified by clinical whole-exome sequencing (WES) to have novel de novo variants in PURA with a similar phenotype of hypotonia and developmental delay and frequently associated with seizures. The protein Pur? (encoded by PURA) is involved in neuronal proliferation, dendrite maturation, and the transport of mRNA to translation sites during neuronal development. Mutations in PURA may alter normal brain development and impair neuronal function, leading to developmental delay and the seizures observed in patients with mutations in PURA.

| S-EPMC4850890 | biostudies-literature

Diagnosis of Schaaf-Yang syndrome in Korean children with developmental delay and hypotonia.

Project description:AbstractSchaaf-Yang syndrome (SYS) is a recently identified disorder caused by a loss-of-function mutation in a maternally imprinted gene, MAGEL2, at 15q11.2q13. Due to its extreme rarity and wide range of clinical severity, clinical suspicion is difficult for a physician. In the current study, its frequency among the Korean pediatric patients with developmental delay (DD) or intellectual disability (ID) was assessed. As the first report of Korean patients with SYS, our study aims to increase the awareness of this condition among the physicians taking care of the pediatric patients with DD/ID and hypotonia.The patients diagnosed with SYS by whole-exome sequencing (WES) among the 460 Korean pediatric patients with DD/ID were included, and their clinical and molecular features were reviewed.Four patients (0.9%) were diagnosed with SYS. Profound DD (4 patients), multiple anomalies including joint contractures and facial dysmorphism (4 patients), generalized hypotonia (3 patients), and severe respiratory difficulty requiring mechanical ventilation (3 patients) were noted in most cases, similar to those in previous reports. Sleep apnea (2 patients), autistic features (2 patients), a high grade of gastroesophageal reflux (1 patient), and seizures (1 patient) were found as well. A total of 3 different truncating MAGEL2 mutations were identified. A previously-reported mutation, to be the most common one, c.1996dupC, was found in 2 patients. The other 2 mutations, c.2217delC and c.3449_3450delTT were novel mutations. As MAGEL2 is maternally imprinted, 2 patients had inherited the MAGEL2 mutation from their respective healthy fathers.SYS is an extremely rare cause of DD/ID. However, hypotonia, joint contractures, profound DD/ID and facial dysmorphism are the suggestive clinical features for SYS. As a maternally imprinted disorder, it should be reminded that SYS may be inherited in form of a mutation from a healthy father.

| S-EPMC7748310 | biostudies-literature

A Missense Mutation in the UGDH Gene Is Associated With Developmental Delay and Axial Hypotonia.

Project description:UDP-glucose dehydrogenase (UGDH) encodes an oxidoreductase that converts two successive oxidations of UDP-glucose to produce UDP-glucuronic acid, a key component in the synthesis of several polysaccharides such as glycosaminoglycan and the disaccharide hyaluronic acid. UGDH is critical to the production of extracellular matrix components which are essential to the migration and connectivity of neurons early in human brain development. In this report, we describe one child of a consanguineous family who presented with distinct clinical features including global developmental delay, axial hypotonia, bilateral undescended testis, and subtle dysmorphic features. Whole genome sequencing and a segregation was performed to identify the genetic cause of the disease within the family. Though mutations in the UGDH protein have been described as causing developmental delay in various model organisms, to our knowledge, this is the first identification of the novel homozygous missense variant in exon8 of UGDH NM_003359.3: c.950 G>A (p.Arg317Gln) and most likely the cause of the patient's phenotype. This variant falls in an active region and replaces the highly conserved Arginine 317 residues across mammals.

| S-EPMC7056728 | biostudies-literature

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

Project description:Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3.

| S-EPMC5701309 | biostudies-literature

A de novo missense mutation in ZMYND11 is associated with global developmental delay, seizures, and hypotonia.

Project description:Recently, mutations in the zinc finger MYND-type containing 11 (ZMYND11) gene were identified in patients with autism spectrum disorders, intellectual disability, aggression, and complex neuropsychiatric features, supporting that this gene is implicated in 10p15.3 microdeletion syndrome. We report a novel de novo variant in the ZMYND11 gene (p.Ser421Asn) in a patient with a complex neurodevelopmental phenotype. The patient is a 24-yr-old Caucasian/Filipino female with seizures, global developmental delay, sensorineural hearing loss, hypotonia, dysmorphic features, and other features including a happy disposition and ataxic gait similar to Angelman syndrome. In addition, this patient had uncommon features including eosinophilic esophagitis and multiple, severe allergies not described in similar ZMYND11 cases. This new case further supports the association of ZMYND11 with autistic-like phenotypes and suggests that ZMYND11 should be included in the list of potentially causative candidate genes in cases with complex neurodevelopmental phenotypes.

| S-EPMC5002929 | biostudies-literature

Variants in GNAI1 cause a syndrome associated with variable features including developmental delay, seizures, and hypotonia.

Project description:PurposeNeurodevelopmental disorders (NDDs) encompass a spectrum of genetically heterogeneous disorders with features that commonly include developmental delay, intellectual disability, and autism spectrum disorders. We sought to delineate the molecular and phenotypic spectrum of a novel neurodevelopmental disorder caused by variants in the GNAI1 gene.MethodsThrough large cohort trio-based exome sequencing and international data-sharing, we identified 24 unrelated individuals with NDD phenotypes and a variant in GNAI1, which encodes the inhibitory Gαi1 subunit of heterotrimeric G-proteins. We collected detailed genotype and phenotype information for each affected individual.ResultsWe identified 16 unique variants in GNAI1 in 24 affected individuals; 23 occurred de novo and 1 was inherited from a mosaic parent. Most affected individuals have a severe neurodevelopmental disorder. Core features include global developmental delay, intellectual disability, hypotonia, and epilepsy.ConclusionThis collaboration establishes GNAI1 variants as a cause of NDDs. GNAI1-related NDD is most often characterized by severe to profound delays, hypotonia, epilepsy that ranges from self-limiting to intractable, behavior problems, and variable mild dysmorphic features.

| S-EPMC8107131 | biostudies-literature

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

Project description:Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

| S-EPMC7308501 | biostudies-literature

Monoallelic and Biallelic Variants in EMC1 Identified in Individuals with Global Developmental Delay, Hypotonia, Scoliosis, and Cerebellar Atrophy.

Project description:The paradigm of a single gene associated with one specific phenotype and mode of inheritance has been repeatedly challenged. Genotype-phenotype correlations can often be traced to different mutation types, localization of the variants in distinct protein domains, or the trigger of or escape from nonsense-mediated decay. Using whole-exome sequencing, we identified homozygous variants in EMC1 that segregated with a phenotype of developmental delay, hypotonia, scoliosis, and cerebellar atrophy in three families. In addition, a de novo heterozygous EMC1 variant was seen in an individual with a similar clinical and MRI imaging phenotype. EMC1 encodes a member of the endoplasmic reticulum (ER)-membrane protein complex (EMC), an evolutionarily conserved complex that has been proposed to have multiple roles in ER-associated degradation, ER-mitochondria tethering, and proper assembly of multi-pass transmembrane proteins. Perturbations of protein folding and organelle crosstalk have been implicated in neurodegenerative processes including cerebellar atrophy. We propose EMC1 as a gene in which either biallelic or monoallelic variants might lead to a syndrome including intellectual disability and preferential degeneration of the cerebellum.

| S-EPMC4800043 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data