Selection of Shine-Dalgarno sequences in plastids.
Ontology highlight
ABSTRACT:
SUBMITTER: Drechsel O
PROVIDER: S-EPMC3045613 | biostudies-literature | 2011 Mar
REPOSITORIES: biostudies-literature
Publications
Selection of Shine-Dalgarno sequences in plastids.
Drechsel Oliver O Bock Ralph R
Nucleic acids research 20101021 4
Like bacterial genes, most plastid (chloroplast) genes are arranged in operons and transcribed as polycistronic mRNAs. Plastid protein biosynthesis occurs on bacterial-type 70S ribosomes and translation initiation of many (but not all) mRNAs is mediated by Shine-Dalgarno (SD) sequences. To study the mechanisms of SD sequence recognition, we have analyzed translation initiation from mRNAs containing multiple SD sequences. Comparing translational efficiencies of identical transgenic mRNAs in Esche ...[more]
Similar Datasets
Project description:We examined 20,648 prokaryotic unique taxids with respect to the annotation of the 3' end of the 16S rRNA, which contains the anti-Shine-Dalgarno sequence. We used the sequence of highly conserved helix 45 of the 16S rRNA as a guide. By this criterion, 8,153 annotated 3' ends correctly included the anti-Shine-Dalgarno sequence, but 12,495 were foreshortened or otherwise mis-annotated, missing part or all of the anti-Shine-Dalgarno sequence, which immediately follows helix 45. We re-annotated, giving a total of 20,648 16S rRNA 3' ends. The vast majority indeed contained a consensus anti-Shine-Dalgarno sequence, embedded in a highly conserved 13 base "tail". However, 128 exceptional organisms had either a variant anti-Shine-Dalgarno, or no recognizable anti-Shine-Dalgarno, in their 16S rRNA(s). For organisms both with and without an anti-Shine-Dalgarno, we identified the Shine-Dalgarno motifs actually enriched in front of each organism's open reading frames. This showed to what extent the Shine-Dalgarno motifs correlated with anti-Shine Dalgarno motifs. In general, organisms whose rRNAs lacked a perfect anti-Shine-Dalgarno motif also lacked a recognizable Shine-Dalgarno. For organisms whose 16S rRNAs contained a perfect anti-Shine-Dalgarno motif, a variety of results were obtained. We found one genus, Alteromonas, where several taxids apparently maintain two different types of 16S rRNA genes, with different, but conserved, antiSDs. The fact that some organisms do not seem to have or use Shine-Dalgarno motifs supports the idea that prokaryotes have other robust mechanisms for recognizing start codons for translation.
| S-EPMC6107228 | biostudies-literature
Project description:The Shine-Dalgarno (SD) sequence motif facilitates translation initiation and is frequently found upstream of bacterial start codons. However, thousands of instances of this motif occur throughout the middle of protein coding genes in a typical bacterial genome. Here, we use comparative evolutionary analysis to test whether SD sequences located within genes are functionally constrained. We measure the conservation of SD sequences across Enterobacteriales, and find that they are significantly less conserved than expected. Further, the strongest SD sequences are the least conserved whereas we find evidence of conservation for the weakest possible SD sequences given amino acid constraints. Our findings indicate that most SD sequences within genes are likely to be deleterious and removed via selection. To illustrate the origin of these deleterious costs, we show that ATG start codons are significantly depleted downstream of SD sequences within genes, highlighting the constraint that these sequences impose on the surrounding nucleotides to minimize the potential for erroneous translation initiation.
| S-EPMC6188533 | biostudies-literature
Project description:Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.
| S-EPMC3927391 | biostudies-literature
Project description:Efficient and accurate protein synthesis is crucial for organismal survival in competitive environments. Translation efficiency (the number of proteins translated from a single mRNA in a given time period) is the combined result of differential translation initiation, elongation, and termination rates. Previous research identified the Shine-Dalgarno (SD) sequence as a modulator of translation initiation in bacterial genes, while codon usage biases are frequently implicated as a primary determinant of elongation rate variation. Recent studies have suggested that SD sequences within coding sequences may negatively affect translation elongation speed, but this claim remains controversial. Here, we present a metric to quantify the prevalence of SD sequences in coding regions. We analyze hundreds of bacterial genomes and find that the coding sequences of highly expressed genes systematically contain fewer SD sequences than expected, yielding a robust correlation between the normalized occurrence of SD sites and protein abundances across a range of bacterial taxa. We further show that depletion of SD sequences within ribosomal protein genes is correlated with organismal growth rates, supporting the hypothesis of strong selection against the presence of these sequences in coding regions and suggesting their association with translation efficiency in bacteria.
| S-EPMC5100845 | biostudies-literature
Project description:Microorganisms require efficient translation to grow and replicate rapidly, and translation is often rate-limited by initiation. A prominent feature that facilitates translation initiation in bacteria is the Shine-Dalgarno (SD) sequence. However, there is much debate over its conservation in Cyanobacteria and in chloroplasts which presumably originated from endosymbiosis of ancient Cyanobacteria. Elucidating the utilization of SD sequences in Cyanobacteria and in chloroplasts is therefore important to understand whether 1) SD role in Cyanobacterial translation has been reduced prior to chloroplast endosymbiosis or 2) translation in Cyanobacteria and in plastid has been subjected to different evolutionary pressures. To test these alternatives, we employed genomic, proteomic, and transcriptomic data to trace differences in SD usage among Synechocystis species, Microcystis aeruginosa, cyanophages, Nicotiana tabacum chloroplast, and Arabidopsis thaliana chloroplast. We corrected their mis-annotated 16S rRNA 3' terminus using an RNA-Seq-based approach to determine their SD/anti-SD locational constraints using an improved measurement DtoStart. We found that cyanophages well-mimic Cyanobacteria in SD usage because both have been under the same selection pressure for SD-mediated initiation. Whereas chloroplasts lost this similarity because the need for SD-facilitated initiation has been reduced in plastids having much reduced genome size and different ribosomal proteins as a result of host-symbiont coevolution. Consequently, SD sequence significantly increases protein expression in Cyanobacteria but not in chloroplasts, and only Cyanobacterial genes compensate for a lack of SD sequence by having weaker secondary structures at the 5' UTR. Our results suggest different evolutionary pressures operate on translation initiation in Cyanobacteria and in chloroplast.
| S-EPMC6847405 | biostudies-literature
Project description:Shine-Dalgarno sequences (SD) in prokaryotic mRNA facilitate protein translation by pairing with rRNA in ribosomes. Although conventionally defined as AG-rich motifs, recent genomic surveys reveal great sequence diversity, questioning how SD functions. Here, we determined the molecular fitness (i.e., translation efficiency) of 49 synthetic 9-nt SD genotypes in three distinct mRNA contexts in Escherichia coli We uncovered generic principles governing the SD fitness landscapes: (1) Guanine contents, rather than canonical SD motifs, best predict the fitness of both synthetic and endogenous SD; (2) the genotype-fitness correlation of SD promotes its evolvability by steadily supplying beneficial mutations across fitness landscapes; and (3) the frequency and magnitude of deleterious mutations increase with background fitness, and adjacent nucleotides in SD show stronger epistasis. Epistasis results from disruption of the continuous base pairing between SD and rRNA. This "chain-breaking" epistasis creates sinkholes in SD fitness landscapes and may profoundly impact the evolution and function of prokaryotic translation initiation and other RNA-mediated processes. Collectively, our work yields functional insights into the SD sequence variation in prokaryotic genomes, identifies a simple design principle to guide bioengineering and bioinformatic analysis of SD, and illuminates the fundamentals of fitness landscapes and molecular evolution.
| S-EPMC7263185 | biostudies-literature
Project description:A unique 373 bp region (igr66) between grpE and dnaK of Streptococcus mutans lacks a promoter but is required for optimal production of DnaK. Northern blotting using probes specific to hrcA, igr66 or dnaK revealed multiple transcripts produced from the dnaK operon and 5'-RACE mapped 5' termini of multiple dnaK transcripts within igr66. One product mapped to a predicted 5'-SL (stem-loop) and two others mapped just 5' to Shine-Dalgarno (SD)-like sequences located immediately upstream to dnaK and to a predicted SL 120 bp upstream of the dnaK start codon (3'-SL). A collection of cat reporter-gene strains containing mutant derivatives of igr66 were engineered. Chloramphenicol acetyltransferase (CAT) activity varied greatly between strains, but there were no correlative changes in cat mRNA levels. Interestingly, mutations introduced into the SD-like sequences 5' to the 3'-SL resulted in an 83-98% decrease in CAT activity. Markerless point mutations introduced upstream of dnaK in the SD-like sequences impaired growth at elevated temperatures and resulted in up to a 40% decrease in DnaK protein after heat shock. Collectively, these results indicate processing within igr66 enhances translation in a temperature dependent manner via non-canonical ribosome binding sites positioned >120 bp upstream of dnaK.
| S-EPMC4666293 | biostudies-literature
Project description:In prokaryotes, Shine-Dalgarno (SD) sequences, nucleotides upstream from start codons on messenger RNAs (mRNAs) that are complementary to ribosomal RNA (rRNA), facilitate the initiation of protein synthesis. The location of SD sequences relative to start codons and the stability of the hybridization between the mRNA and the rRNA correlate with the rate of synthesis. Thus, accurate characterization of SD sequences enhances our understanding of how an organism's transcriptome relates to its cellular proteome. We implemented the Individual Nearest Neighbor Hydrogen Bond model for oligo-oligo hybridization and created a new metric, relative spacing (RS), to identify both the location and the hybridization potential of SD sequences by simulating the binding between mRNAs and single-stranded 16S rRNA 3' tails. In 18 prokaryote genomes, we identified 2,420 genes out of 58,550 where the strongest binding in the translation initiation region included the start codon, deviating from the expected location for the SD sequence of five to ten bases upstream. We designated these as RS+1 genes. Additional analysis uncovered an unusual bias of the start codon in that the majority of the RS+1 genes used GUG, not AUG. Furthermore, of the 624 RS+1 genes whose SD sequence was associated with a free energy release of less than -8.4 kcal/mol (strong RS+1 genes), 384 were within 12 nucleotides upstream of in-frame initiation codons. The most likely explanation for the unexpected location of the SD sequence for these 384 genes is mis-annotation of the start codon. In this way, the new RS metric provides an improved method for gene sequence annotation. The remaining strong RS+1 genes appear to have their SD sequences in an unexpected location that includes the start codon. Thus, our RS metric provides a new way to explore the role of rRNA-mRNA nucleotide hybridization in translation initiation.
| S-EPMC1463019 | biostudies-literature
Project description:Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3'-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of ?-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level.
| S-EPMC5711450 | biostudies-literature
Project description:In prokaryotes, translation initiation typically depends on complementary binding between a G-rich Shine-Dalgarno (SD) motif in the 5' untranslated region of mRNAs, and the 3' tail of the 16S ribosomal RNA (the anti-SD sequence). In some cases, internal SD-like motifs in the coding region generate "programmed" ribosomal pauses that are beneficial for protein folding or accurate targeting. On the other hand, such pauses can also reduce protein production, generating purifying selection against internal SD-like motifs. This selection should be stronger in GC-rich genomes that are more likely to harbor the G-rich SD motif. However, the nature and consequences of selection acting on internal SD-like motifs within genomes and across species remains unclear. We analyzed the frequency of SD-like hexamers in the coding regions of 284 prokaryotes (277 with known anti-SD sequences and 7 without a typical SD mechanism). After accounting for GC content, we found that internal SD-like hexamers are avoided in 230 species, including three without a typical SD mechanism. The degree of avoidance was higher in GC-rich genomes, mesophiles, and N-terminal regions of genes. In contrast, 54 species either showed no signature of avoidance or were enriched in internal SD-like motifs. C-terminal gene regions were relatively enriched in SD-like hexamers, particularly for genes in operons or those followed closely by downstream genes. Together, our results suggest that the frequency of internal SD-like hexamers is governed by multiple factors including GC content and genome organization, and further empirical work is necessary to understand the evolution and functional roles of these motifs.
| S-EPMC4943179 | biostudies-literature