Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A 10 bp deletion polymorphism and 2 new variations in the GLUT1 gene associated with meningomyelocele.

ABSTRACT: We sought to examine the diversity and extent of sequence variations in GLUT1 in patients with myelomeningocele (MM) and to identify variations conferring risk of MM. Sequences of the 10 exons and exon-intron boundaries of GLUT1 for 96 patients with MM (48 Caucasians and 48 Mexican Americans) were determined by direct sequencing of DNA. Two new variants were identified. One is located within intron 7 (c.972+17t>a), 17 bases from exon 7. The other is within exon 8 (c.1016T>C) and results in an amino acid change at isoleucine 339 (p.Ile339Thr). A 10 base pair (bp) deletion within intron 9 was genotyped for 457 patients with MM and showed it to be more common in Caucasian MM patients than in Caucasian controls (P = .02). The physiologic role of the 2 newly identified variants in the GLUT1 gene and the 10 bp deletion associated with risk of MM in Caucasian patients is under investigation.

SUBMITTER: Cormier CM

PROVIDER: S-EPMC3117222 | biostudies-literature | 2011 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

A 10 bp deletion polymorphism and 2 new variations in the GLUT1 gene associated with meningomyelocele.

Cormier Clint M CM Au Kit Sing KS Northrup Hope H

Reproductive sciences (Thousand Oaks, Calif.) 20101206 5

We sought to examine the diversity and extent of sequence variations in GLUT1 in patients with myelomeningocele (MM) and to identify variations conferring risk of MM. Sequences of the 10 exons and exon-intron boundaries of GLUT1 for 96 patients with MM (48 Caucasians and 48 Mexican Americans) were determined by direct sequencing of DNA. Two new variants were identified. One is located within intron 7 (c.972+17t>a), 17 bases from exon 7. The other is within exon 8 (c.1016T>C) and results in an am ...[more]

PMID: 21135204

Similar Datasets

Susceptibility to preeclampsia is associated with a 50-bp insertion/deletion polymorphism at the promoter region of the <i>SOD1</i> gene

Project description:ObjectiveThere is much evidence that oxidative stress is involved in the pathogenesis of preeclampsia (PE). A 50 bp insertion/deletion (Ins/Del) functional polymorphism in the promoter region of SOD1 has been reported. Due to a total lack of data, the aim of this study was to investigate the association between the SOD1 (Ins/Del) polymorphism and the risk of PE.Material and methodsThe current hospital-based case-control study included a total of 172 preeclamptic and 171 non-preeclamptic pregnancies. Genotyping was performed using the polymerase chain reaction method.ResultsStatistical analysis revealed that the Del/Del genotype significantly correlated with susceptibility to PE [odds ratio (OR): 6.53, 95% confidence interval (CI): 1.43-29.7, p=0.015]. Since maternal body mass index, family history of PE in first degree relatives, and educational levels were statistically associated with the susceptibility to PE, further analyses were carried out in order to estimate the adjusted ORs. After adjustment for aforementioned variables, the Del/Del genotype increased the risk of PE (OR: 5.98, 95% CI: 1.21-29.5, p=0.028).ConclusionThe 50 bp Ins/Del in promoter region of the SOD1 gene could be an intriguing susceptibility factor for developing preeclampsia in Iranian Caucasians.

| S-EPMC8666992 | biostudies-literature

Risk of meningomyelocele mediated by the common 22q11.2 deletion.

Project description:Meningomyelocele is one of the most severe forms of neural tube defects (NTDs) and the most frequent structural birth defect of the central nervous system. We assembled the Spina Bifida Sequencing Consortium to identify causes. Exome and genome sequencing of 715 parent-offspring trios identified six patients with chromosomal 22q11.2 deletions, suggesting a 23-fold increased risk compared with the general population. Furthermore, analysis of a separate 22q11.2 deletion cohort suggested a 12- to 15-fold increased NTD risk of meningomyelocele. The loss of Crkl, one of several neural tube-expressed genes within the minimal deletion interval, was sufficient to replicate NTDs in mice, where both penetrance and expressivity were exacerbated by maternal folate deficiency. Thus, the common 22q11.2 deletion confers substantial meningomyelocele risk, which is partially alleviated by folate supplementation.

| S-EPMC11849314 | biostudies-literature

Association study of the 2-bp deletion polymorphism in exon 6 of the CHRFAM7A gene with idiopathic generalized epilepsy.

Project description:There is evidence of linkage between the 15q13-q14 locus, containing the gene encoding the α7 subunit (CHRNA7) of the neuronal nicotinic acetylcholine receptor (nAChR) and its partially duplicated isoform (CHRFAM7A), and epilepsy. Additionally, a 2-bp deletion polymorphism (c.497-498delTG; rs67158670) in CHRFAM7A, resulting in a frame shift and truncation of the protein product, is associated with some neurological diseases. This study was designed to explore the possibility of an association of the c.497-498delTG polymorphism of CHRFAM7A with idiopathic generalized epilepsies (IGEs) in Polish children and young patients. The study included 197 IGE patients and 258 unrelated healthy individuals. The frequency of the CHRFAM7A c.497-498delTG polymorphism was determined in each group using heteroduplex analysis. An association between the c.497-498delTG polymorphism of CHRFAM7A and IGE was evidenced. It was demonstrated that the frequency of the CHRFAM7A 2-bp deletion carriers was significantly lower in the IGE patients than in the control group. The observed frequency of 2-bp deletion carriers was high in IGE subjects (64%), but significantly higher in control subjects (76%). Carriers of at least one copy of the -2 bp allele had halved their risk of IGE susceptibility (delTG/delTG and delTG/wild-type versus wild-type/wild-type: odds ratio=0.55; 95% confidence intervals=0.365-0.827; p=0.004). Moreover, it has been demonstrated that this polymorphic variant is associated with the c.524-12_524-11insGTT variation (rs10649395) in intron 7 of CHRFAM7A. Our study substantiates the involvement of the α7 subunit of nAChR in the pathophysiology of IGEs and indicates that the CHRFAM7A c.497-498TG deletion or a nearby polymorphism may play a role in the pathogenesis of IGE. Further work should concentrate on ascertaining the exact mechanism of this polymorphism's effect and its relationship with IGE.

| S-EPMC3806399 | biostudies-literature

Association between the 2-bp deletion polymorphism in the duplicated version of the alpha7 nicotinic receptor gene and P50 sensory gating.

Project description:There is considerable evidence implicating the 15q13.3 region in neuropsychiatric disorders, with the ?7 nicotinic receptor gene CHRNA7 the most plausible candidate. This region has multiple duplications and many copy number variants (CNVs). A common CNV involves a partial duplication of CHRNA7 (CHRFAM7A), which occurs in either orientation. We examined the distribution of these alternative genomic arrangements in a large cohort of psychiatric patients, their relatives and controls using the 2-bp deletion polymorphism as a marker for the orientation of CHRFAM7A. We investigated three common alleles for association with psychosis and with the P50 sensory gating deficit, which is strongly associated with psychosis and strongly linked to 15q13.3. We found significant within-family association with P50 (empirical P=0.004), which is robust to population stratification. Most of the effect came from the 2-bp deletion allele, which tags the variant of CHRFAM7A in the same orientation as CHRNA7. This allele is associated with the presence of the P50 sensory gating deficit (empirical P=0.0006). Tests comparing within-family and between-family components of association suggest considerable population stratification in the sample. We found no evidence for association with psychosis, but this may reflect lower power using this phenotype. Four out of six previous association studies found association of different psychiatric phenotypes with the same 2-bp deletion allele.

| S-EPMC3522190 | biostudies-literature

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

Project description:Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

| S-EPMC5399899 | biostudies-literature

HLA-G 14?bp deletion/insertion polymorphism and mother-to-child transmission of HIV.

Project description:The human leukocyte antigen HLA-G, highly expressed at the maternal-fetal interface, has a pivotal role in mediating immune tolerance. In this study we investigated the influence of HLA-G 14?bp insertion polymorphism in human immunodeficiency virus (HIV)-1 mother-to-child HIV-1 transmission. The 14?bp insertion polymorphism was analyzed among 99 HIV-1 positive mothers and 329 infants born to HIV-positive mothers in Zambia, among whom vertical transmission status and timing had been determined. HLA-G 14?bp insertion polymorphism was detected using a custom TaqMan single nucleotide polymorphisms (SNPs) genotyping assay. Logistic regression was conducted to examine the associations between HLA-G alleles and the risk of HIV transmission. The 14?bp insertion allele was more frequent in HIV exposed-uninfected (EU) infants than in infected infants, and was associated with reduced risk of both in utero (IU) and intrapartum (IP) HIV transmission, after adjusting for maternal cluster of differentiation 4 (CD4) cell count and plasma viral load. Maternal HLA-G 14?bp insertion genotype and HLA-G concordance between mother and child were not associated with the risk of perinatal HIV transmission. The presence of the 14?bp insertion associates with protection toward IU and IP HIV infection in children from Zambia, suggesting that HLA-G could be involved in the vertical transmission of HIV.

| S-EPMC3950813 | biostudies-other

A 39-bp deletion polymorphism in PTEN in African American individuals: implications for molecular diagnostic testing.

Project description:Germline mutations in the PTEN/MMAC1/TEP1 tumor suppressor gene cause Cowden syndrome (CS), a hereditary hamartoma-tumor syndrome with an increased risk of breast, thyroid, and endometrial cancers, and seemingly unrelated developmental disorders, such as Bannayan-Riley-Ruvalcaba (BRR) syndrome, Proteus, and Proteus-like syndromes. Data to date suggest that irrespective of the clinical presentation, the identification of a PTEN mutation should trigger medical management which includes cancer surveillance. Clinic-based molecular diagnostic testing for germline PTEN mutations has been available for at least 2 years. This study reports on the finding of a previously unobserved heterozygous alteration (IVS7-15-->53del39) found in an African American individual who had features of CS. Further investigation revealed that 12 of 42 (28.6%) African American controls, but not individuals of Caucasian or Japanese origin, also carried this heterozygous 39-bp deletion in PTEN. Due to its location immediately upstream of the splicing site of exon 8, this polymorphism could be mistaken for a deleterious mutation in the PTEN.

| S-EPMC1906990 | biostudies-literature

Astute Clinician Report: A Novel 10 bp Frameshift Deletion in Exon 2 of ICOS Causes a Combined Immunodeficiency Associated with an Enteritis and Hepatitis.

Project description:ICOS encodes the Inducible T-cell Co-Stimulator (ICOS). Deficiency of this receptor in humans causes a common variable immunodeficiency (CVID) characterised by an absence of class-switched memory B cells and hypogammaglobulinemia. Three pathogenic mutations in ICOS have been described to date in a total of 13 cases. Here we report a novel homozygous 10 base pair frameshift deletion in exon 2 discovered by whole exome sequencing of two siblings from a family of Pakistani origin. Both patients presented in early childhood with diarrhea, colitis and transaminitis and one showed defective handling of human herpesvirus 6. Activated patient CD3(+)CD4(+) T lymphocytes demonstrated a complete absence of ICOS expression and, consistent with previous reports, we detected a reduction in circulating T follicular helper cells. Findings in this kindred emphasise the phenotypic variability of ICOS deficiency and, in particular, the variably impaired antiviral immunity that is a poorly understood facet of this rare disorder.

| S-EPMC4628077 | biostudies-literature

A novel 2 bp deletion variant in Ovine-DRB1 gene is associated with increased Visna/maedi susceptibility in Turkish sheep.

Project description:Visna/maedi (VM) is a multisystemic lentivirus infection of sheep that affecting sheep industry across the globe. TMEM154 gene has been identified to be a major VM-associated host gene, nevertheless, a recent study showed that the frequency of the VM-resistant TMEM154 haplotypes was very low or absent in indigenous sheep. Thus, the present study was designed to determine other possible co-receptors associated with VM. For this purpose, DRB1 gene, which is renowned for its role in host immune response against various diseases was targeted. A total number of 151 case-control matched pairs were constructed from 2266 serologically tested sheep. A broad range of DRB1 haplotype diversity was detected by sequence-based genotyping. Moreover, a novel 2 bp deletion (del) in the DRB1 intron 1 was identified. For the final statistic, the sheep carrying VM-resistant TMEM154 diplotypes were removed and a McNemar's test with a matched pairs experimental design was conducted. Consequently, it was identified for the first time that the 2 bp del variant is a genetic risk factor for VM (p value 0.002; chi-square 8.31; odds ratio 2.9; statistical power 0.90) in the dominant model. Thus, negative selection for 2 bp del variant could decrease VM infection risk in Turkish sheep.

| S-EPMC8280167 | biostudies-literature

Association between 19-bp Insertion/Deletion Polymorphism of Dopamine β-Hydroxylase and Autism Spectrum Disorder in Thai Patients.

Project description:Background and Objectives: Autism spectrum disorder (ASD) is a neurodevelopmental disorder the cause of which is not fully known. Genetic factors are believed to play a major role in the etiology of ASD. However, genetic factors have been identified in only some cases, and other causes remain to be identified. This study aimed to identify potential associations between ASD and the 19-bp insertion/deletion polymorphism in the dopamine beta-hydroxylase (DBH) gene which plays a crucial role in the metabolism of neurotransmitters. Materials and Methods: The 19-bp insertion/deletion polymorphism upstream of the DBH gene was analyzed for associations in 177 ASD patients and 250 healthy controls. Family-based analysis was performed in family trios of each patient using the transmission disequilibrium test to investigate the potential contributions of this DBH polymorphism to ASD. Results: The frequency of the 19-bp insertion allele was significantly higher in the patient group compared to the controls (0.624 vs. 0.556, respectively; p = 0.046). The frequency of the insertion/insertion genotype was also higher in the patient group (0.378 vs. 0.288, respectively) but without statistical significance (p = 0.110). The family-based analysis showed an association between patient families and the insertion allele when only families of male participants were analyzed (73 vs. 48 events; OR 1.521; 95% CI 1.057-2.189; p = 0.023). Conclusions: This population-based analysis found an association between the 19-bp insertion allele of the DBH gene and ASD. No association at the genotype level was found. The family-based analysis found an association between the insertion allele and ASD when the analysis was performed on male participants only, suggesting a linkage between the DBH locus and ASD.

| S-EPMC9504840 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data