Browse
Submit Data
Databases
API
Help

Dataset Information

18 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A 10 bp deletion polymorphism and 2 new variations in the GLUT1 gene associated with meningomyelocele.

ABSTRACT: We sought to examine the diversity and extent of sequence variations in GLUT1 in patients with myelomeningocele (MM) and to identify variations conferring risk of MM. Sequences of the 10 exons and exon-intron boundaries of GLUT1 for 96 patients with MM (48 Caucasians and 48 Mexican Americans) were determined by direct sequencing of DNA. Two new variants were identified. One is located within intron 7 (c.972+17t>a), 17 bases from exon 7. The other is within exon 8 (c.1016T>C) and results in an amino acid change at isoleucine 339 (p.Ile339Thr). A 10 base pair (bp) deletion within intron 9 was genotyped for 457 patients with MM and showed it to be more common in Caucasian MM patients than in Caucasian controls (P = .02). The physiologic role of the 2 newly identified variants in the GLUT1 gene and the 10 bp deletion associated with risk of MM in Caucasian patients is under investigation.

SUBMITTER: Cormier CM

PROVIDER: S-EPMC3117222 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Susceptibility to preeclampsia is associated with a 50-bp insertion/deletion polymorphism at the promoter region of the <i>SOD1</i> gene

Project description:ObjectiveThere is much evidence that oxidative stress is involved in the pathogenesis of preeclampsia (PE). A 50 bp insertion/deletion (Ins/Del) functional polymorphism in the promoter region of SOD1 has been reported. Due to a total lack of data, the aim of this study was to investigate the association between the SOD1 (Ins/Del) polymorphism and the risk of PE.Material and methodsThe current hospital-based case-control study included a total of 172 preeclamptic and 171 non-preeclamptic pregnancies. Genotyping was performed using the polymerase chain reaction method.ResultsStatistical analysis revealed that the Del/Del genotype significantly correlated with susceptibility to PE [odds ratio (OR): 6.53, 95% confidence interval (CI): 1.43-29.7, p=0.015]. Since maternal body mass index, family history of PE in first degree relatives, and educational levels were statistically associated with the susceptibility to PE, further analyses were carried out in order to estimate the adjusted ORs. After adjustment for aforementioned variables, the Del/Del genotype increased the risk of PE (OR: 5.98, 95% CI: 1.21-29.5, p=0.028).ConclusionThe 50 bp Ins/Del in promoter region of the SOD1 gene could be an intriguing susceptibility factor for developing preeclampsia in Iranian Caucasians.

| S-EPMC8666992 | biostudies-literature

Association study of the 2-bp deletion polymorphism in exon 6 of the CHRFAM7A gene with idiopathic generalized epilepsy.

Project description:There is evidence of linkage between the 15q13-q14 locus, containing the gene encoding the α7 subunit (CHRNA7) of the neuronal nicotinic acetylcholine receptor (nAChR) and its partially duplicated isoform (CHRFAM7A), and epilepsy. Additionally, a 2-bp deletion polymorphism (c.497-498delTG; rs67158670) in CHRFAM7A, resulting in a frame shift and truncation of the protein product, is associated with some neurological diseases. This study was designed to explore the possibility of an association of the c.497-498delTG polymorphism of CHRFAM7A with idiopathic generalized epilepsies (IGEs) in Polish children and young patients. The study included 197 IGE patients and 258 unrelated healthy individuals. The frequency of the CHRFAM7A c.497-498delTG polymorphism was determined in each group using heteroduplex analysis. An association between the c.497-498delTG polymorphism of CHRFAM7A and IGE was evidenced. It was demonstrated that the frequency of the CHRFAM7A 2-bp deletion carriers was significantly lower in the IGE patients than in the control group. The observed frequency of 2-bp deletion carriers was high in IGE subjects (64%), but significantly higher in control subjects (76%). Carriers of at least one copy of the -2 bp allele had halved their risk of IGE susceptibility (delTG/delTG and delTG/wild-type versus wild-type/wild-type: odds ratio=0.55; 95% confidence intervals=0.365-0.827; p=0.004). Moreover, it has been demonstrated that this polymorphic variant is associated with the c.524-12_524-11insGTT variation (rs10649395) in intron 7 of CHRFAM7A. Our study substantiates the involvement of the α7 subunit of nAChR in the pathophysiology of IGEs and indicates that the CHRFAM7A c.497-498TG deletion or a nearby polymorphism may play a role in the pathogenesis of IGE. Further work should concentrate on ascertaining the exact mechanism of this polymorphism's effect and its relationship with IGE.

| S-EPMC3806399 | biostudies-literature

HLA-G 14?bp deletion/insertion polymorphism and mother-to-child transmission of HIV.

Project description:The human leukocyte antigen HLA-G, highly expressed at the maternal-fetal interface, has a pivotal role in mediating immune tolerance. In this study we investigated the influence of HLA-G 14?bp insertion polymorphism in human immunodeficiency virus (HIV)-1 mother-to-child HIV-1 transmission. The 14?bp insertion polymorphism was analyzed among 99 HIV-1 positive mothers and 329 infants born to HIV-positive mothers in Zambia, among whom vertical transmission status and timing had been determined. HLA-G 14?bp insertion polymorphism was detected using a custom TaqMan single nucleotide polymorphisms (SNPs) genotyping assay. Logistic regression was conducted to examine the associations between HLA-G alleles and the risk of HIV transmission. The 14?bp insertion allele was more frequent in HIV exposed-uninfected (EU) infants than in infected infants, and was associated with reduced risk of both in utero (IU) and intrapartum (IP) HIV transmission, after adjusting for maternal cluster of differentiation 4 (CD4) cell count and plasma viral load. Maternal HLA-G 14?bp insertion genotype and HLA-G concordance between mother and child were not associated with the risk of perinatal HIV transmission. The presence of the 14?bp insertion associates with protection toward IU and IP HIV infection in children from Zambia, suggesting that HLA-G could be involved in the vertical transmission of HIV.

| S-EPMC3950813 | biostudies-other

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

Project description:Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

| S-EPMC5399899 | biostudies-literature

Association between the 2-bp deletion polymorphism in the duplicated version of the alpha7 nicotinic receptor gene and P50 sensory gating.

Project description:There is considerable evidence implicating the 15q13.3 region in neuropsychiatric disorders, with the ?7 nicotinic receptor gene CHRNA7 the most plausible candidate. This region has multiple duplications and many copy number variants (CNVs). A common CNV involves a partial duplication of CHRNA7 (CHRFAM7A), which occurs in either orientation. We examined the distribution of these alternative genomic arrangements in a large cohort of psychiatric patients, their relatives and controls using the 2-bp deletion polymorphism as a marker for the orientation of CHRFAM7A. We investigated three common alleles for association with psychosis and with the P50 sensory gating deficit, which is strongly associated with psychosis and strongly linked to 15q13.3. We found significant within-family association with P50 (empirical P=0.004), which is robust to population stratification. Most of the effect came from the 2-bp deletion allele, which tags the variant of CHRFAM7A in the same orientation as CHRNA7. This allele is associated with the presence of the P50 sensory gating deficit (empirical P=0.0006). Tests comparing within-family and between-family components of association suggest considerable population stratification in the sample. We found no evidence for association with psychosis, but this may reflect lower power using this phenotype. Four out of six previous association studies found association of different psychiatric phenotypes with the same 2-bp deletion allele.

| S-EPMC3522190 | biostudies-literature

A 39-bp deletion polymorphism in PTEN in African American individuals: implications for molecular diagnostic testing.

Project description:Germline mutations in the PTEN/MMAC1/TEP1 tumor suppressor gene cause Cowden syndrome (CS), a hereditary hamartoma-tumor syndrome with an increased risk of breast, thyroid, and endometrial cancers, and seemingly unrelated developmental disorders, such as Bannayan-Riley-Ruvalcaba (BRR) syndrome, Proteus, and Proteus-like syndromes. Data to date suggest that irrespective of the clinical presentation, the identification of a PTEN mutation should trigger medical management which includes cancer surveillance. Clinic-based molecular diagnostic testing for germline PTEN mutations has been available for at least 2 years. This study reports on the finding of a previously unobserved heterozygous alteration (IVS7-15-->53del39) found in an African American individual who had features of CS. Further investigation revealed that 12 of 42 (28.6%) African American controls, but not individuals of Caucasian or Japanese origin, also carried this heterozygous 39-bp deletion in PTEN. Due to its location immediately upstream of the splicing site of exon 8, this polymorphism could be mistaken for a deleterious mutation in the PTEN.

| S-EPMC1906990 | biostudies-literature

Astute Clinician Report: A Novel 10 bp Frameshift Deletion in Exon 2 of ICOS Causes a Combined Immunodeficiency Associated with an Enteritis and Hepatitis.

Project description:ICOS encodes the Inducible T-cell Co-Stimulator (ICOS). Deficiency of this receptor in humans causes a common variable immunodeficiency (CVID) characterised by an absence of class-switched memory B cells and hypogammaglobulinemia. Three pathogenic mutations in ICOS have been described to date in a total of 13 cases. Here we report a novel homozygous 10 base pair frameshift deletion in exon 2 discovered by whole exome sequencing of two siblings from a family of Pakistani origin. Both patients presented in early childhood with diarrhea, colitis and transaminitis and one showed defective handling of human herpesvirus 6. Activated patient CD3(+)CD4(+) T lymphocytes demonstrated a complete absence of ICOS expression and, consistent with previous reports, we detected a reduction in circulating T follicular helper cells. Findings in this kindred emphasise the phenotypic variability of ICOS deficiency and, in particular, the variably impaired antiviral immunity that is a poorly understood facet of this rare disorder.

| S-EPMC4628077 | biostudies-literature

Lack of Association Between Dopamine Beta-Hydroxylase (DBH) 19-bp Insertion/Deletion Polymorphism and Risk of Schizophrenia.

Project description:Objective: Interaction between genetic and environmental factors is considered as major factors in Schizophrenia (SCZ). It has been shown that dopaminergic and noradrenergic neurotransmission dysfunction play an essential role in the SCZ pathogenesis. This study aimed to find the impact of functional 19-bp insertion/deletion (ins/del) polymorphism in dopamine beta-hydroxylase (DBH) gene on SCZ risk in a sample of Iranian population. Method: This case-control study was conducted on 109 SCZ patients and 116 matched healthy subjects. Genomic DNA samples were extracted from peripheral blood cells using salting out method. Genotyping of 19-bp ins/del DBH polymorphism was done using Polymerase Chain Reaction (PCR) method. Results: Neither the overall chi-square comparison of cases and controls (?2 = 0.56, p = 0.756), nor the logistic regression analysis (which was computed in codominant, dominant and recessive model of inheritance) showed any association between DBH 19-bp I/D and SCZ in a sample of southeast Iranian population. Conclusion: Overall, our results did not support an association between DBH 19-bp I/D polymorphism and risk/protection of SCZ.

| S-EPMC5206326 | biostudies-other

Is the polymorphism at position -1082 of IL-10 gene associated with visceral leishmaniasis?

Project description:BACKGROUND: Immune responses play critical roles in the leishmaniasis eradication. IL-10 is a key regulator of immune responses, and the polymorphisms within its promoter region are associated with alteration in its expression. Therefore, this study was designed to examine the correlation between polymorphism at the -1082 position of the IL-10 gene and visceral leishmaniasis (VL). METHODS: The IL-10 -1082 polymorphism and anti-Leishmania antibody titration were examined in 110 patients with clinical presentation of VL and seropositive for the Leishmania (group 1), 74 seropositive patients but without clinical presentation (group 2) and 113 healthy controls (group 3) using the PCR-RFLP and immunofluorescence techniques, respectively. RESULTS: The polymorphism at IL-10 -1082 (A/G) position was significantly associated with VL and A/G genotype was significantly higher in VL patients when compared to the groups 2 and 3 (P< 0.001). However, the results demonstrated that the A and G alleles were not associated with VL (P= 0.263). CONCLUSIONS: Previous investigations have shown that the polymorphism at the -1082 position of the IL-10 gene can influence its expression and also it has been proved that IL-10 level was increased during VL. Our results suggest that the A/G genotype may be considered as a risk factor for VL.

| S-EPMC4411907 | biostudies-other

Interleukin 10 gene rs1800896 polymorphism is associated with the risk of prostate cancer.

Project description:Numerous studies have uncovered the association of Interleukin-10 (IL-10) gene rs1800896 polymorphism with the risk of prostate cancer (PCa); however, their conclusions were inconsistent. Therefore, we conducted this meta-analysis to evaluate the role of IL-10 rs1800896 polymorphism in the risk of PCa. 16 eligible studies in 15 articles involving 6,301 cases and 6,510 controls were identified by researching PubMed, Google, CNKI, and EMBASE up to April 1, 2017. Our results revealed that IL-10 rs1800896 polymorphism was associated with the decreased risk of PCa under the homozygous model. Subgroup analysis by ethnicity revealed that rs1800896 polymorphism decreased the risk of PCa among Caucasians. In conclusion, IL-10 gene rs1800896 polymorphism is associated with the decreased risk of PCa. Larger studies with more diverse ethnic populations are needed to confirm these results.

| S-EPMC5630404 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data