Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Exome sequencing identifies CCDC8 mutations in 3-M syndrome, suggesting that CCDC8 contributes in a pathway with CUL7 and OBSL1 to control human growth.

ABSTRACT: 3-M syndrome, a primordial growth disorder, is associated with mutations in CUL7 and OBSL1. Exome sequencing now identifies mutations in CCDC8 as a cause of 3-M syndrome. CCDC8 is a widely expressed gene that is transcriptionally associated to CUL7 and OBSL1, and coimmunoprecipitation indicates a physical interaction between CCDC8 and OBSL1 but not CUL7. We propose that CUL7, OBSL1, and CCDC8 are members of a pathway controlling mammalian growth.

SUBMITTER: Hanson D

PROVIDER: S-EPMC3135816 | biostudies-literature | 2011 Jul

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Exome sequencing identifies CCDC8 mutations in 3-M syndrome, suggesting that CCDC8 contributes in a pathway with CUL7 and OBSL1 to control human growth.

Hanson Dan D Murray Philip G PG O'Sullivan James J Urquhart Jill J Daly Sarah S Bhaskar Sanjeev S SS Biesecker Leslie G LG Skae Mars M Smith Claire C Cole Trevor T Kirk Jeremy J Chandler Kate K Kingston Helen H Donnai Dian D Clayton Peter E PE Black Graeme C M GC

American journal of human genetics 20110707 1

3-M syndrome, a primordial growth disorder, is associated with mutations in CUL7 and OBSL1. Exome sequencing now identifies mutations in CCDC8 as a cause of 3-M syndrome. CCDC8 is a widely expressed gene that is transcriptionally associated to CUL7 and OBSL1, and coimmunoprecipitation indicates a physical interaction between CCDC8 and OBSL1 but not CUL7. We propose that CUL7, OBSL1, and CCDC8 are members of a pathway controlling mammalian growth. ...[more]

PMID: 21737058

Similar Datasets

Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma.

Project description:In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n?=?238) or synonymous (n?=?85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n?=?71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-?B, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies.

| S-EPMC5335658 | biostudies-other

Exome sequencing identifies MLL2 mutations as a cause of Kabuki syndrome.

Project description:We demonstrate the successful application of exome sequencing to discover a gene for an autosomal dominant disorder, Kabuki syndrome (OMIM%147920). We subjected the exomes of ten unrelated probands to massively parallel sequencing. After filtering against existing SNP databases, there was no compelling candidate gene containing previously unknown variants in all affected individuals. Less stringent filtering criteria allowed for the presence of modest genetic heterogeneity or missing data but also identified multiple candidate genes. However, genotypic and phenotypic stratification highlighted MLL2, which encodes a Trithorax-group histone methyltransferase: seven probands had newly identified nonsense or frameshift mutations in this gene. Follow-up Sanger sequencing detected MLL2 mutations in two of the three remaining individuals with Kabuki syndrome (cases) and in 26 of 43 additional cases. In families where parental DNA was available, the mutation was confirmed to be de novo (n = 12) or transmitted (n = 2) in concordance with phenotype. Our results strongly suggest that mutations in MLL2 are a major cause of Kabuki syndrome.

| S-EPMC2930028 | biostudies-literature

Exome sequencing identifies PDE4D mutations in acrodysostosis.

Project description:Acrodysostosis is a dominantly-inherited, multisystem disorder characterized by skeletal, endocrine, and neurological abnormalities. To identify the molecular basis of acrodysostosis, we performed exome sequencing on five genetically independent cases. Three different missense mutations in PDE4D, which encodes cyclic AMP (cAMP)-specific phosphodiesterase 4D, were found to be heterozygous in three of the cases. Two of the mutations were demonstrated to have occurred de novo, providing strong genetic evidence of causation. Two additional cases were heterozygous for de novo missense mutations in PRKAR1A, which encodes the cAMP-dependent regulatory subunit of protein kinase A and which has been recently reported to be the cause of a form of acrodysostosis resistant to multiple hormones. These findings demonstrate that acrodysostosis is genetically heterogeneous and underscore the exquisite sensitivity of many tissues to alterations in cAMP homeostasis.

| S-EPMC3322224 | biostudies-literature

Exome and genome sequencing of nasopharynx cancer identifies NF-?B pathway activating mutations.

Project description:Nasopharyngeal carcinoma (NPC) is an aggressive head and neck cancer characterized by Epstein-Barr virus (EBV) infection and dense lymphocyte infiltration. The scarcity of NPC genomic data hinders the understanding of NPC biology, disease progression and rational therapy design. Here we performed whole-exome sequencing (WES) on 111 micro-dissected EBV-positive NPCs, with 15 cases subjected to further whole-genome sequencing (WGS), to determine its mutational landscape. We identified enrichment for genomic aberrations of multiple negative regulators of the NF-?B pathway, including CYLD, TRAF3, NFKBIA and NLRC5, in a total of 41% of cases. Functional analysis confirmed inactivating CYLD mutations as drivers for NPC cell growth. The EBV oncoprotein latent membrane protein 1 (LMP1) functions to constitutively activate NF-?B signalling, and we observed mutual exclusivity among tumours with somatic NF-?B pathway aberrations and LMP1-overexpression, suggesting that NF-?B activation is selected for by both somatic and viral events during NPC pathogenesis.

| S-EPMC5253631 | biostudies-literature

Whole exome sequencing identifies three novel mutations in ANTXR1 in families with GAPO syndrome.

Project description:GAPO syndrome (OMIM#230740) is the acronym for growth retardation, alopecia, pseudoanodontia, and optic atrophy. About 35 cases have been reported, making it among one of the rarest recessive conditions. Distinctive craniofacial features including alopecia, rarefaction of eyebrows and eyelashes, frontal bossing, high forehead, mid-facial hypoplasia, hypertelorism, and thickened eyelids and lips make GAPO syndrome a clinically recognizable phenotype. While this genomic study was in progress mutations in ANTXR1 were reported to cause GAPO syndrome. In our study we performed whole exome sequencing (WES) for five affected individuals from three Turkish kindreds segregating the GAPO trait. Exome sequencing analysis identified three novel homozygous mutations including; one frame-shift (c.1220_1221insT; p.Ala408Cysfs*2), one splice site (c.411A>G; p.Gln137Gln), and one non-synonymous (c.1150G>A; p.Gly384Ser) mutation in the ANTXR1 gene. Our studies expand the allelic spectrum in this rare condition and potentially provide insight into the role of ANTXR1 in the regulation of the extracellular matrix.

| S-EPMC4332576 | biostudies-literature

Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

Project description:Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

| S-EPMC4370767 | biostudies-literature

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

Project description:BACKGROUND:3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS:Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS:We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION:These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

| S-EPMC7370744 | biostudies-literature

Exome sequencing identifies BRAF mutations in papillary craniopharyngiomas.

Project description:Craniopharyngiomas are epithelial tumors that typically arise in the suprasellar region of the brain. Patients experience substantial clinical sequelae from both extension of the tumors and therapeutic interventions that damage the optic chiasm, the pituitary stalk and the hypothalamic area. Using whole-exome sequencing, we identified mutations in CTNNB1 (?-catenin) in nearly all adamantinomatous craniopharyngiomas examined (11/12, 92%) and recurrent mutations in BRAF (resulting in p.Val600Glu) in all papillary craniopharyngiomas (3/3, 100%). Targeted genotyping revealed BRAF p.Val600Glu in 95% of papillary craniopharyngiomas (36 of 39 tumors) and mutation of CTNNB1 in 96% of adamantinomatous craniopharyngiomas (51 of 53 tumors). The CTNNB1 and BRAF mutations were clonal in each tumor subtype, and we detected no other recurrent mutations or genomic aberrations in either subtype. Adamantinomatous and papillary craniopharyngiomas harbor mutations that are mutually exclusive and clonal. These findings have important implications for the diagnosis and treatment of these neoplasms.

| S-EPMC3982316 | biostudies-literature

Exome sequencing identifies ZNF644 mutations in high myopia.

Project description:Myopia is the most common ocular disorder worldwide, and high myopia in particular is one of the leading causes of blindness. Genetic factors play a critical role in the development of myopia, especially high myopia. Recently, the exome sequencing approach has been successfully used for the disease gene identification of Mendelian disorders. Here we show a successful application of exome sequencing to identify a gene for an autosomal dominant disorder, and we have identified a gene potentially responsible for high myopia in a monogenic form. We captured exomes of two affected individuals from a Han Chinese family with high myopia and performed sequencing analysis by a second-generation sequencer with a mean coverage of 30× and sufficient depth to call variants at ?97% of each targeted exome. The shared genetic variants of these two affected individuals in the family being studied were filtered against the 1000 Genomes Project and the dbSNP131 database. A mutation A672G in zinc finger protein 644 isoform 1 (ZNF644) was identified as being related to the phenotype of this family. After we performed sequencing analysis of the exons in the ZNF644 gene in 300 sporadic cases of high myopia, we identified an additional five mutations (I587V, R680G, C699Y, 3'UTR+12 C>G, and 3'UTR+592 G>A) in 11 different patients. All these mutations were absent in 600 normal controls. The ZNF644 gene was expressed in human retinal and retinal pigment epithelium (RPE). Given that ZNF644 is predicted to be a transcription factor that may regulate genes involved in eye development, mutation may cause the axial elongation of eyeball found in high myopia patients. Our results suggest that ZNF644 might be a causal gene for high myopia in a monogenic form.

| S-EPMC3111487 | biostudies-literature

Genomic analysis-integrated whole-exome sequencing of neuroblastomas identifies genetic mutations in axon guidance pathway.

Project description:Neuroblastoma (NB) is a childhood solid malignant tumor originating from precursor cells of the peripheral nervous system. We have previously established a risk classification system based on DNA copy number profiles. To further explore the pathogenesis of NBs in distinct risk groups, we performed whole-exome sequencing analysis of 57 primary and 7 recurrent/metastatic tumors with unique chromosomal aberration profiles as categorized by our genomic sub-grouping system. Overall, a low frequency of somatic mutations was found. Besides ALK (4/64, 6.3%), SEMA6C, SLIT1 and NRAS, genes involved in the axon guidance pathway, were identified as recurrently mutated in 6 of 64 tumors (9.4%). Pathway enrichment analysis revealed enrichment of 25 mutated genes in the mitogen-activated protein kinase (MAPK) pathway, 13 genes in the Wnt pathway, and 12 genes in the axon guidance pathway. Genomic analyses demonstrated that primary and matched recurrent or metastatic tumors obtained from sporadic and monozygotic twin NBs were clonally related with variable extents of genetic heterogeneity. Monozygotic twin NBs displayed different evolutionary trajectories. These results indicate the involvement of the axon guidance, MAPK and Wnt pathways in NB and demonstrate genomic diversity with NB progression.

| S-EPMC5593593 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data