Dataset Information

Small-interference RNA gene knockdown of pancreatitis-associated proteins in rat acute pancreatitis.

ABSTRACT: Pancreatitis-associated proteins (PAPs) are induced in acute pancreatitis and antisense-mediated gene knockdown of PAP decreased PAP gene expression and worsened pancreatitis. Here, we investigated the effect of a more stable inhibition of PAP using small-interference RNA gene knockdown in vitro and in an in vivo model of experimental pancreatitis.Pancreatitis-associated protein-specific siRNA was administered to AR42J cell cultures or rats induced with pancreatitis. Controls included administration of scrambled siRNA or vehicle alone. After 24 hours, cells and pancreata were harvested and assessed for PAP (PAP 1, PAP 2, PAP 3) gene expression and pancreatitis severity.In vitro, PAP protein, and mRNA levels were reduced (PAP 1, 76%; PAP 2, 8%; PAP 3, 24%) in cells treated with PAP siRNA. In vivo, PAP 1, and PAP 3 expressions were reduced (PAP 1, 36%; PAP 3, 66%) in siRNA-treated rats; there was no difference in PAP 2 isoform mRNA expression and serum protein levels. Serum amylase and lipase levels decreased (> or =50%) after administration of siRNA; interleukin (IL) 1beta, IL-4, and IL-6 increased, whereas C-reactive protein and tumor necrosis factor-alpha decreased when compared with vehicle control. Administration of PAP siRNA correlated with worsening histopathology.siRNA-mediated gene knockdown of PAP worsens pancreatitis. Differences in gene knockdown technology may provide different approaches to study gene function.

SUBMITTER: Lin YY

PROVIDER: S-EPMC3151650 | biostudies-literature | 2008 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Small-interference RNA gene knockdown of pancreatitis-associated proteins in rat acute pancreatitis.

Lin Yin-Yao YY Viterbo Domenico D Mueller Cathy M CM Stanek Albert E AE Smith-Norowitz Tamar T Drew Hazel H Wadgaonkar Raj R Zenilman Michael E ME Bluth Martin H MH

Pancreas 20080501 4

<h4>Objectives</h4>Pancreatitis-associated proteins (PAPs) are induced in acute pancreatitis and antisense-mediated gene knockdown of PAP decreased PAP gene expression and worsened pancreatitis. Here, we investigated the effect of a more stable inhibition of PAP using small-interference RNA gene knockdown in vitro and in an in vivo model of experimental pancreatitis.<h4>Methods</h4>Pancreatitis-associated protein-specific siRNA was administered to AR42J cell cultures or rats induced with pancrea ...[more]

PMID: 18437087

Similar Datasets

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Project description:Qingyi decoction (QYD) has anti-inflammatory pharmacological properties and substantial therapeutic benefits on severe acute pancreatitis (SAP) in clinical practice. However, its protective mechanism against SAP-associated acute lung injury (ALI) remains unclear. In this study, we screened the active ingredients of QYD from the perspective of network pharmacology to identify its core targets and signaling pathways against SAP-associated ALI. Rescue experiments were used to determine the relationship between QYD and ferroptosis. Then, metabolomics and 16s rDNA sequencing were used to identify differential metabolites and microbes in lung tissue. Correlation analysis was utilized to explore the relationship between core targets, signaling pathways, metabolic phenotypes, and microbial flora, sorting out the potential molecular network of QYD against SAP-associated lung ALI. Inflammatory damage was caused by SAP in the rat lung. QYD could effectively alleviate lung injury, improve respiratory function, and significantly reduce serum inflammatory factor levels in SAP rats. Network pharmacology and molecular docking identified three key targets: ALDH2, AnxA1, and ICAM-1. Mechanistically, QYD may inhibit ferroptosis by promoting the ALDH2 expression and suppress neutrophil infiltration by blocking the cleavage of intact AnxA1 and downregulating ICAM-1 expression. Ferroptosis activator counteracts the pulmonary protective effect of QYD in SAP rats. In addition, seven significant differential metabolites were identified in lung tissues. QYD relatively improved the lung microbiome's abundance in SAP rats. Further correlation analysis determined the correlation between ferroptosis, differential metabolites, and differential microbes. In this work, the network pharmacology, metabolomics, and 16s rDNA sequencing were integrated to uncover the mechanism of QYD against SAP-associated ALI. This novel integrated method may play an important role in future research on traditional Chinese medicine.

Project description:Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury without destabilizing the vessel wall.

Dataset Information

Small-interference RNA gene knockdown of pancreatitis-associated proteins in rat acute pancreatitis.

Publications

Small-interference RNA gene knockdown of pancreatitis-associated proteins in rat acute pancreatitis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets