Dataset Information

Establishment and characterization of Prnp knockdown neuroblastoma cells using dual microRNA-mediated RNA interference.

ABSTRACT: Prion diseases are fatal transmissible neurodegenerative disorders. In the pathogenesis of the disease, the cellular prion protein (PrPC) is required for replication of abnormal prion (PrPSc), which results in accumulation of PrPSc. Although there have been extensive studies using Prnp knockout systems, the normal function of PrPC remains ambiguous. Compared with conventional germline knockout technologies and transient naked siRNA-dependent knockdown systems, newly constructed durable chained-miRNA could provide a cell culture model that is closer to the disease status and easier to achieve with no detrimental sequelae. The selective silencing of a target gene by RNA interference (RNAi) is a powerful approach to investigate the unknown function of genes in vitro and in vivo. To reduce PrPC expression, a novel dual targeting-microRNA (miRdual) was constructed. The miRdual, which targets N- and C- termini of Prnp simultaneously, more effectively suppressed PrPC expression compared with conventional single site targeting. Furthermore, to investigate the cellular change following PrPC depletion, gene expression analysis of PrPC interacting and/or associating genes and several assays including proliferation, viability and apoptosis were performed. The transcripts 670460F02Rik and Plk3, Ppp2r2b and Csnk2a1 increase in abundance and are reported to be involved in cell proliferation and mitochondrial-mediated apoptosis. Dual-targeting RNAi with miRdual against Prnp will be useful for analyzing the physiological function of PrPC in neuronal cell lines and may provide a potential therapeutic intervention for prion diseases in the future.

SUBMITTER: Kang SG

PROVIDER: S-EPMC3166508 | biostudies-literature | 2011 Apr-Jun

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Establishment and characterization of Prnp knockdown neuroblastoma cells using dual microRNA-mediated RNA interference.

Kang Sang-Gyun SG Roh Yu-Mi YM Lau Agnes A Westaway David D McKenzie Debbie D Aiken Judd J Kim Yong-Sun YS Yoo Han Sang HS

Prion 20110401 2

Prion diseases are fatal transmissible neurodegenerative disorders. In the pathogenesis of the disease, the cellular prion protein (PrPC) is required for replication of abnormal prion (PrPSc), which results in accumulation of PrPSc. Although there have been extensive studies using Prnp knockout systems, the normal function of PrPC remains ambiguous. Compared with conventional germline knockout technologies and transient naked siRNA-dependent knockdown systems, newly constructed durable chained-m ...[more]

PMID: 21494092

Similar Datasets

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Project description:Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury without destabilizing the vessel wall.

Dataset Information

Establishment and characterization of Prnp knockdown neuroblastoma cells using dual microRNA-mediated RNA interference.

Publications

Establishment and characterization of Prnp knockdown neuroblastoma cells using dual microRNA-mediated RNA interference.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets