Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Analysis of avian hepatitis E virus from chickens, China.

ABSTRACT: Avian hepatitis E virus (HEV) has been identified in chickens; however, only 4 complete or near-complete genomic sequences have been reported. We found that the near-complete genomic sequence of avian HEV in chickens from China shared the highest identity (98.3%) with avian HEV from Europe and belonged to avian HEV genotype 3.

SUBMITTER: Zhao Q

PROVIDER: S-EPMC3294992 | biostudies-literature | 2010 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Analysis of avian hepatitis E virus from chickens, China.

Zhao Qin Q Zhou En Min EM Dong Shi Wei SW Qiu Hong Kai HK Zhang Lu L Hu Shou Bin SB Zhao Fei Fei FF Jiang Shi Jin SJ Sun Ya Ni YN

Emerging infectious diseases 20100901 9

Avian hepatitis E virus (HEV) has been identified in chickens; however, only 4 complete or near-complete genomic sequences have been reported. We found that the near-complete genomic sequence of avian HEV in chickens from China shared the highest identity (98.3%) with avian HEV from Europe and belonged to avian HEV genotype 3. ...[more]

PMID: 20735936

Similar Datasets

Avian hepatitis E virus in chickens, Taiwan, 2013.

Project description:A previously unidentified strain of avian hepatitis E virus (aHEV) is now endemic among chickens in Taiwan. Analysis showed that the virus is 81.5%-86.5% similar to other aHEVs. In Taiwan, aHEV infection has been reported in chickens without aHEV exposure, suggesting transmission from asymptomatic cases or repeated introduction through an unknown common source(s).

| S-EPMC3884734 | biostudies-literature

Subclinical highly pathogenic avian influenza virus infection among vaccinated chickens, China.

Project description:Subclinical infection of vaccinated chickens with a highly pathogenic avian influenza A(H5N2) virus was identified through routine surveillance in China. Investigation suggested that the virus has evolved into multiple genotypes. To better control transmission of the virus, we recommend a strengthened program of education, biosecurity, rapid diagnostics, surveillance, and elimination of infected poultry.

| S-EPMC4257838 | biostudies-literature

Seroprevalence of avian hepatitis E virus and avian leucosis virus subgroup J in chicken flocks with hepatitis syndrome, China.

Project description:From 2014 to 2015 in China, many broiler breeder and layer hen flocks exhibited a decrease in egg production and some chickens developed hepatitis syndrome including hepatomegaly, hepatic necrosis and hemorrhage. Avian hepatitis E virus (HEV) and avian leucosis virus subgroup J (ALV-J) both cause decreasing in egg production, hepatomegaly and hepatic hemorrhage in broiler breeder and layer hens. In the study, the seroprevalence of avian HEV and ALV-J in these flocks emerging the disease from Shandong and Shaanxi provinces were investigated.A total of 1995 serum samples were collected from 14 flocks with hepatitis syndrome in Shandong and Shaanxi provinces, China. Antibodies against avian HEV and ALV-J in these serum samples were detected using iELISAs. The seroprevalence of anti-avian HEV antibodies (35.09%) was significantly higher than that of anti-ALV-J antibodies (2.16%) (p?=?0.00). Moreover, the 43 serum samples positive for anti-ALV-J antibodies were all also positive for anti-avian HEV antibodies. In a comparison of both provinces, Shandong chickens exhibited a significantly higher seroprevalence of anti-avian HEV antibodies (42.16%) than Shaanxi chickens (26%) (p?=?0.00). In addition, the detection of avian HEV RNA and ALV-J cDNA in the liver samples from the flocks of two provinces also showed the same results of the seroprevalence.In the present study, the results showed that avian HEV infection is widely prevalent and ALV-J infection is endemic in the flocks with hepatitis syndrome from Shandong and Shaanxi provinces of China. These results suggested that avian HEV infection may be the major cause of increased egg drop and hepatitis syndrome observed during the last 2 years in China. These results should be useful to guide development of prevention and control measures to control the diseases within chicken flocks in China.

| S-EPMC5120538 | biostudies-literature

Diversity of Avian leukosis virus subgroup J in local chickens, Jiangxi, China.

Project description:Avian leukosis caused by avian leukosis virus (ALV) is one of the most severe diseases endangering the poultry industry. When the eradication measures performed in commercial broilers and layers have achieved excellent results, ALV in some local chickens has gradually attracted attention. Since late 2018, following the re-outbreak of ALV-J in white feather broilers in China, AL-like symptoms also suddenly broke out in some local flocks, leading to great economic losses. In this study, a systematic epidemiological survey was carried out in eight local chicken flocks in Jiangxi Province, China, and 71 strains were finally isolated from 560 samples, with the env sequences of them being successfully sequenced. All of those new isolates belong to subgroup J but they have different molecular features and were very different from the strains that emerged in white feature broilers recently, with some strains being highly consistent with those previously isolated from commercial broilers, layers and other flocks or even isolated from USA and Russian, suggesting these local chickens have been acted as reservoirs to accumulate various ALV-J strains for a long time. More seriously, phylogenetic analysis shows that there were also many novel strains emerging and in a separate evolutionary branch, indicating several new mutated ALVs are being bred in local chickens. Besides, ALV-J strains isolated in this study can be further divided into ten groups, while there were more or fewer groups in different chickens, revealing that ALV may cross propagate in those flocks. The above analyses explain the complex background and future evolution trend of ALV-J in Chinese local chickens, providing theoretical support for the establishment of corresponding prevention and control measures.

| S-EPMC7910287 | biostudies-literature

Isolation and pathogenicity testing of avian reticuloendotheliosis virus from layer chickens in China.

Project description:Reticuloendotheliosis virus (REV) can cause runting, immunosuppression, acute reticulum cell neoplasia, and chronic lymphoid tumors in a variety of domestic and wild birds. We diagnosed a case of reticuloendotheliosis with obvious tumors in liver and kidney. We isolated and sequenced the virus and performed pathogenicity testing of the REV strain. Immunohistochemistry and PCR confirmed that the diseased layer chickens were infected with REV. The strain, named BJ1503, was successfully isolated from the case by inoculation of tissue homogenates onto chicken embryo fibroblasts. The length of the proviral REV genome is 8,293 nucleotides. The isolate had 99.7% identity with REV-HA9901 (AY842951.1), which was isolated from Jiangsu, China, in 1999. The chickens infected with REV-BJ1503 had depressed weight gain and lymphoid atrophy. Our findings suggest that REV isolate BJ1503 was phylogenetically close to the earlier strain found in China, with minor variations, and the virus was associated with severe production problems.

| S-EPMC7377614 | biostudies-literature

Avian hepatitis E virus is widespread among chickens in Poland and belongs to genotype 2.

Project description:Big liver and spleen disease, caused by avian hepatitis E virus, has been reported in Poland, but the prevalence of the virus has not yet been investigated. In this study, 1034 serum samples from 57 breeder broiler and laying hen flocks were screened for the presence of anti-aHEV antibodies. In a random serology study, 56.1% of flocks were positive. Seroprevalence was higher in laying hen flocks than in broiler breeder flocks. Phylogenetic analysis of partial ORF1 and ORF2 sequences revealed that all Polish isolates belonged to genotype 2. This is the first time this genotype has been detected in Central Europe.

| S-EPMC6373257 | biostudies-literature

Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis.

Project description:One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.

| S-EPMC7165564 | biostudies-literature

Avian metapneumovirus subgroup C infection in chickens, China.

Project description:Avian metapneumovirus causes acute respiratory tract infection and reductions in egg production in various avian species. We isolated and characterized an increasingly prevalent avian metapneumovirus subgroup C strain from meat-type commercial chickens with severe respiratory signs in China. Culling of infected flocks could lead to economic consequences.

| S-EPMC3903454 | biostudies-literature

Avian leukosis virus subgroup J associated with the outbreak of erythroblastosis in chickens in China.

Project description:BACKGROUND: Emaciation, depression and lethargy were observed in two flocks of Chinese local breed and one flock of commercial layer chicken infected naturally from 2010 to 2011. The aims of this study were to diagnose. METHODS AND RESULTS: Gross observation showed that severe enlargement of liver, spleen and kidney, and hemorrhage of thymus, muscle and glandular stomach in all submitted birds. The liver and lung of one flock had diffuse, multifocal white raised foci on the surface as well as on the cut-surface. Numerous erythrocytoblasts with bigger volume, basophilic cytoplasm and round nucleus were observed in blood and bone marrow smears. The same erythrocytoblasts were also found crowded in blood vessels and mesenchym of tissues by histological examination, and some had mitotic figures. PCR results showed that three flocks were positive for ALV-J with specific fragment of 924?bp, negative for AEV, ALV-A, ALV-B, Marek's disease virus (MDV) and Reticuloendotheliosis virus (REV). The results of immunohistochemistry showed that cytoplasm of histiocytes and erythrocytoblasts in lung and spleen sections was positive for ALV-J antigen. CONCLUSION: These data demonstrated that erythroblastosis was all induced by ALV-J in the three different flocks. This is the first document report of erythroblastosis induced by ALV-J in China flocks.

| S-EPMC3614479 | biostudies-literature

Isolation, identification and genome analysis of an avian hepatitis E virus from white-feathered broilers in China.

Project description:Avian hepatitis E virus (HEV) is the major causative pathogen of the big liver and spleen disease, hepatitis-splenomegaly syndrome, and hepatic rupture hemorrhage syndrome. Until now, there are 6 different avian HEV genotypes that infect chickens have been reported worldwide. Epidemiologic investigations of the avian HEV demonstrated that avian HEV has been widely spread in China in recent years. In this study, an avian HEV named YT-aHEV was obtained from white-feathered broilers using LMH cells by virus isolation assay in Shandong province, China. The complete genome consists of 6656-nt excluding the poly(A) tail. The isolate was highly similar to the CaHEV strain and segregated into the same branch belonging to avian HEV genotype 3. Indirect immunofluorescence using capsid protein-specific polyclonal antibodies confirmed that YT-aHEV could establish productive infection and replicate stably in LMH cells. Furthermore, an in vivo avian HEV infection model was established successfully in specific pathogen-free chicken embryos by intravenous experiments. In the present study, we demonstrate an avian HEV infection associated with liver lesions of hemorrhage and swelling by LMH cells for the first time in a white-feather broiler flock in China. This research also provides a new diagnosis method for detection of avian HEV, which laid a foundation for the understanding of pathogenicity and molecular biology of this virus for further study.

| S-EPMC8743215 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data