Dataset Information

The 5' flanking region and intron1 of the bovine prion protein gene (PRNP) are responsible for negative feedback regulation of the prion protein.

ABSTRACT: Transcription factors regulate gene expression by controlling the transcription rate. Some genes can repress their own expression to prevent over production of the corresponding protein, although the mechanism and significance of this negative feedback regulation remains unclear. In the present study, we describe negative feedback regulation of the bovine prion protein (PrP) gene PRNP in Japanese Black cattle. The PrP-expressing plasmid pEF-boPrP and luciferase-expressing plasmids containing the partial promoter fragment of PRNP incorporating naturally occurring single-nucleotide or insertion/deletion polymorphisms were transfected into N2a cells. Transfection of pEF-boPrP induced PrP overexpression and decreased the promoter activity of PRNP in the wild-type haplotype (23-bp Del, 12-bp Del, and -47C). Reporter gene assays further demonstrated that the 12- and 23-bp Ins/Del polymorphisms, which are thought to be associated with Sp1 (Specific protein 1) and RP58 (Repressor Protein with a predicted molecular mass of 58 kDa), in intron1 and the upstream region, respectively, and an additional polymorphism (-47C?A) in the Sp1-binding site responded differently to PrP overexpression. With the -47C SNP, the presence of the Del in either the 23-bp Ins/Del or the 12-bp Ins/Del allele was essential for the negative feedback caused by PrP overexpression. Furthermore, deletion mutants derived from the wild-type haplotype showed that nucleotides -315 to +2526, which include the 5'-flanking region and exon1, were essential for the response. These results indicate that certain negative feedback response elements are located in these sequences, suggesting that regulation by transcription factors such as Sp1 and RP58 may contribute to the negative feedback mechanism of PRNP.

SUBMITTER: Xue G

PROVIDER: S-EPMC3296761 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Project description:High prion protein (PrP) levels are associated with breast, colon and gastric cancer resistance to treatment and with a poor prognosis for the patients. However, little is known about the underlying molecular mechanism(s) regulating human PrP gene (PRNP) expression in cancers. Because endoplasmic reticulum (ER) stress is associated with solid tumors, we investigated a possible regulation of PRNP gene expression by ER stress.Published microarray databases of breast cancer tissues and breast carcinoma cell lines were analyzed for PrP mRNA and ER stress marker immunoglobulin heavy chain binding protein (BiP) levels. Breast cancer tissue microarrays (TMA) were immunostained for BiP and PrP. Breast carcinoma MCF-7, MDA-MB-231, HS578T and HCC1500 cells were treated with three different ER stressors - Brefeldin A, Tunicamycin, Thapsigargin - and levels of PrP mRNA or protein assessed by RT-PCR and Western blot analyses. A human PRNP promoter-luciferase reporter was used to assess transcriptional activation by ER stressors. Site-directed mutagenesis identified the ER stress response elements (ERSE). Chromatin immunoprecipitation (ChIP) analyses were done to identify the ER stress-mediated transcriptional regulators. The role of cleaved activating transcription factor 6? (?ATF6?) and spliced X-box protein-1 (sXBP1) in PRNP gene expression was assessed with over-expression or silencing techniques. The role of PrP protection against ER stress was assessed with PrP siRNA and by using Prnp null cell lines.We find that mRNA levels of BiP correlated with PrP transcript levels in breast cancer tissues and breast carcinoma cell lines. PrP mRNA levels were enriched in the basal subtype and were associated with poor prognosis in breast cancer patients. Higher PrP and BiP levels correlated with increasing tumor grade in TMA. ER stress was a positive regulator of PRNP gene transcription in MCF-7 cells and luciferase reporter assays identified one ER stress response element (ERSE) conserved among primates and rodents and three primate-specific ERSEs that regulated PRNP gene expression. Among the various transactivators of the ER stress-regulated unfolded protein response (UPR), ATF6? and XBP1 transactivated PRNP gene expression, but the ability of these varied in different cell types. Functionally, PrP delayed ER stress-induced cell death.These results establish PRNP as a novel ER stress-regulated gene that could increase survival in breast cancers.

Dataset Information

The 5' flanking region and intron1 of the bovine prion protein gene (PRNP) are responsible for negative feedback regulation of the prion protein.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets