Whole exome sequencing reveals a novel mutation in CUL7 in a patient with an undiagnosed growth disorder.
Ontology highlight
ABSTRACT:
SUBMITTER: Dauber A
PROVIDER: S-EPMC3524393 | biostudies-literature | 2013 Jan
REPOSITORIES: biostudies-literature
Publications
Whole exome sequencing reveals a novel mutation in CUL7 in a patient with an undiagnosed growth disorder.
Dauber Andrew A Stoler Joan J Hechter Eliana E Safer Jason J Hirschhorn Joel N JN
The Journal of pediatrics 20120910 1
We present the case of a 19-year-old man with a growth disorder, which was undefined, despite extensive evaluation. Whole exome sequencing demonstrated a novel homozygous frameshift mutation in CUL7, one of the causative genes of 3-M syndrome. We discuss the utility of exome sequencing in diagnosing rare disorders. ...[more]
Similar Datasets
Project description:BackgroundNephronophthisis (NPHP) is a progressive tubulointestinal kidney condition that demonstrates an AR inheritance pattern. Up to now, more than 20 various genes have been detected for NPHP, with NPHP1 as the first one detected. X-prolyl aminopeptidase 3 (XPNPEP3) mutation is related to NPHP-like 1 nephropathy and late onset NPHP.MethodsThe proband (index patient) had polyuria, polydipsia and chronic kidney disease and was clinically suspected of NPHP. After the collection of blood sample from proband and her parents, whole exome sequencing (WES) was performed to identify the possible variants in the proband from a consanguineous marriage. The functional importance of variants was estimated by bioinformatic analysis. In the affected proband and her parents, Sanger sequencing was conducted for variants’ confirmation and segregation analysis.ResultsClinical and paraclinical investigations of the patient was not informative. Using WES, we could detect a novel homozygous frameshift mutation in XPNPEP3 (NM_022098.2: c.719_720insA; p. Q241Tfs*13), and by Sanger sequencing, we demonstrated an insertion in XPNPEP3.ConclusionThe homozygous genotype of the novel p.Q241Tfs*31 variant in XPNPEP3 may cause NPHP in the early childhood age.
| S-EPMC7601541 | biostudies-literature
Project description:PurposeDespite the recognized clinical value of exome-based diagnostics, methods for comprehensive genomic interpretation remain immature. Diagnoses are based on known or presumed pathogenic variants in genes already associated with a similar phenotype. Here, we extend this paradigm by evaluating novel bioinformatics approaches to aid identification of new gene-disease associations.MethodsWe analyzed 119 trios to identify both diagnostic genotypes in known genes and candidate genotypes in novel genes. We considered qualifying genotypes based on their population frequency and in silico predicted effects we also characterized the patterns of genotypes enriched among this collection of patients.ResultsWe obtained a genetic diagnosis for 29 (24%) of our patients. We showed that patients carried an excess of damaging de novo mutations in intolerant genes, particularly those shown to be essential in mice (P = 3.4 × 10(-8)). This enrichment is only partially explained by mutations found in known disease-causing genes.ConclusionThis work indicates that the application of appropriate bioinformatics analyses to clinical sequence data can also help implicate novel disease genes and suggest expanded phenotypes for known disease genes. These analyses further suggest that some cases resolved by whole-exome sequencing will have direct therapeutic implications.
| S-EPMC4791490 | biostudies-literature
Project description:Apolipoprotein (APOE) is implicated and verified as the main risk factor for early-onset Alzheimer's disease (AD). APOE is a protein that binds to lipids and is involved in cholesterol stability. Our paper reports a case of a sporadic early-onset AD (sEOAD) patient of a 54-year-old Korean man, where a novel APOE Leu159Pro heterozygous mutation was revealed upon Whole Exome Sequence analysis. The proband's CSF showed downregulated levels of Aβ42, with unchanged Tau levels. The mutation is in the Low-Density Lipoprotein Receptor (LDLR) region of the APOE gene, which mediates the clearance of APOE lipoproteins. LDLR works as a high-affinity point for APOE. Studies suggest that APOE-LDLR interplay could have varying effects. The LDLR receptor pathway has been previously suggested as a therapeutic target to treat tauopathy. However, the APOE-LDLR interaction has also shown a significant correlation with memory retention. Leu159Pro could be an interesting mutation that could be responsible for a less damaging pattern of AD by suppressing tau-association neurodegeneration while affecting the patient's memory retention and cognitive performance.
| S-EPMC9226417 | biostudies-literature
Project description:BackgroundProgressive encephalopathy with or without lipodystrophy is a rare autosomal recessive childhood-onset seipin-associated neurodegenerative syndrome, leading to developmental regression of motor and cognitive skills. In this study, we introduce a patient with developmental regression and autism. The causative mutation was found by exome sequencing.MethodsThe proband showed a generalized hypertonia and regression of all developmental milestones. Based on the advantages of next-generation sequencing (NGS), whole exome sequencing (WES) was requested. The functional significance of variants was evaluated by NGS-specific prediction servers. Sanger sequencing was used for segregation analysis in the family.ResultsThere was no specific sign in the clinical and paraclinical investigations of the patient to establish a conclusive clinical diagnosis. WES detected a known homozygous nonsense mutation in BSCL2 (NM_001122955.3:c. 985C>T; p.Arg329*). The variant is segregating in the pedigree with an autosomal recessive pattern.ConclusionExome sequencing is a robust method for identifying the candidate gene variants in Mendelian traits.
| S-EPMC5075143 | biostudies-literature
Project description:Rubinstein-Taybi syndrome (RSTS) is a rare condition with a prevalence of 1 in 125,000-720,000 births and characterized by clinical features that include facial, dental, and limb dysmorphology and growth retardation. Most cases of RSTS occur sporadically and are caused by de novo mutations. Cytogenetic or molecular abnormalities are detected in only 55% of RSTS cases. Previous genetic studies have yielded inconsistent results due to the variety of methods used for genetic analysis. The purpose of this study was to use whole exome sequencing (WES) to evaluate the genetic causes of RSTS in a young girl presenting with an Autism phenotype. We used the Autism diagnostic observation schedule (ADOS) and Autism diagnostic interview revised (ADI-R) to confirm her diagnosis of Autism. In addition, various questionnaires were used to evaluate other psychiatric features. We used WES to analyze the DNA sequences of the patient and her parents and to search for de novo variants. The patient showed all the typical features of Autism, WES revealed a de novo frameshift mutation in CREBBP and de novo sequence variants in TNC and IGFALS genes. Mutations in the CREBBP gene have been extensively reported in RSTS patients, while potential missense mutations in TNC and IGFALS genes have not previously been associated with RSTS. The TNC and IGFALS genes are involved in central nervous system development and growth. It is possible for patients with RSTS to have additional de novo variants that could account for previously unexplained phenotypes.
| S-EPMC4394500 | biostudies-literature
Project description:Background3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population.MethodsChildren with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed.ResultsWe identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein.ConclusionThese two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.
| S-EPMC7370744 | biostudies-literature
Project description:The clinical translation of next-generation sequencing has created a paradigm shift in the diagnostic assessment of individuals with suspected rare genetic diseases. Whole-exome sequencing (WES) simultaneously examines the majority of the coding portion of the genome and is rapidly becoming accepted as an efficient alternative to clinical Sanger sequencing for diagnosing genetically heterogeneous disorders. Among reports of the clinical and diagnostic utility of WES, few studies to date have directly compared its concordance to Sanger sequencing, which is considered the clinical "gold standard". We performed a direct comparison of 391 coding and noncoding polymorphisms and variants of unknown significance identified by clinical Sanger sequencing to the WES results of 26 patients. Of the 150 well-covered coding variants identified by Sanger sequencing, 146 (97.3%) were also reported by WES. Nine genes were excluded from the comparison due to consistently low coverage in WES, which might be attributed to the use of older exome capture kits. We performed confirmatory Sanger sequencing of discordant variants; including five variants with discordant bases and four with discordant zygosity. Confirmatory Sanger sequencing supported the original Sanger report for three of the five discordant bases, one was shown to be a false positive supporting the WES data, and one result differed from both the Sanger and WES data. Two of the discordant zygosity results supported Sanger and the other two supported WES data. We report high concordance for well-covered coding variants, supporting the use of WES as a screening tool for heterogeneous disorders, and recommend the use of supplementary Sanger sequencing for poorly-covered genes when the clinical suspicion is high. Importantly, despite remaining difficulties with achieving complete coverage of the whole exome, 10 (38.5%) of the 26 compared patients were diagnosed through WES.
| S-EPMC5023935 | biostudies-other
Project description:Acephalic spermatozoa is a very rare disorder of male infertility. Here, in a patient from from a consanguineous family, we have identified, by whole-exome sequencing, a homozygous mutation (c.G2783A, p.G928D) in the BRDT gene. The gene product, BRDT, is a testis-specific protein that is considered an important drug target for male contraception. The G928D mutation is in the P-TEFb binding domain, which mediates the interaction with transcription elongation factor and might affect the transcriptional activities of downstream genes. By RNA-sequencing analysis of cells expressing the BRDT mutation, we found the p.G928D mutation protein causes mis-regulation of 899 genes compared with BRDT wild-type cells. Furthermore, by Gene Ontology analysis, the upregulated genes in p.G928D cells were enriched in the processes of intracellular transport, RNA splicing, cell cycle and DNA metabolic process, revealing the underlying mechanism of the pathology that leads to acephalic spermatozoa.
| S-EPMC5386733 | biostudies-literature
Project description:The increasing availability of genome-wide analysis has made it possible to rapidly sequence the exome of patients with undiagnosed or unresolved medical conditions. Here, we present the case of a 64-yr-old male patient with schistocytes in the peripheral blood smear and a complex and life-threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based on this finding, atypical hemolytic uremic syndrome was suspected because of a genetic predisposition, and a targeted treatment regime with eculizumab was initiated. Life-threatening hemostatic abnormalities would most likely have persisted had it not been for the implementation of whole-exome sequencing in this particular clinical setting.
| S-EPMC4990812 | biostudies-literature
Project description:Exome sequencing (ES) and genome sequencing (GS) have radically transformed the diagnostic approach to undiagnosed rare/ultrarare Mendelian diseases. Next-generation sequencing (NGS), the technology integral for ES, GS, and most large (100+) gene panels, has enabled previously unimaginable diagnoses, changes in medical management, new treatments, and accurate reproductive risk assessments for patients, as well as new disease gene discoveries. Yet, challenges remain, as most individuals remain undiagnosed with current NGS. Improved NGS technology has resulted in long-read sequencing, which may resolve diagnoses in some patients who do not obtain a diagnosis with current short-read ES and GS, but its effectiveness is unclear, and it is expensive. Other challenges that persist include the resolution of variants of uncertain significance, the urgent need for patients with ultrarare disorders to have access to therapeutics, the need for equity in patient access to NGS-based testing, and the study of ethical concerns. However, the outlook for undiagnosed disease resolution is bright, due to continual advancements in the field.
| S-EPMC10483513 | biostudies-literature