Browse
Submit Data
Databases
API
Help

Dataset Information

12 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Whole exome sequencing reveals a novel mutation in CUL7 in a patient with an undiagnosed growth disorder.

ABSTRACT: We present the case of a 19-year-old man with a growth disorder, which was undefined, despite extensive evaluation. Whole exome sequencing demonstrated a novel homozygous frameshift mutation in CUL7, one of the causative genes of 3-M syndrome. We discuss the utility of exome sequencing in diagnosing rare disorders.

SUBMITTER: Dauber A

PROVIDER: S-EPMC3524393 | biostudies-literature | 2013 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Whole exome sequencing reveals a novel mutation in CUL7 in a patient with an undiagnosed growth disorder.

Dauber Andrew A Stoler Joan J Hechter Eliana E Safer Jason J Hirschhorn Joel N JN

The Journal of pediatrics 20120910 1

We present the case of a 19-year-old man with a growth disorder, which was undefined, despite extensive evaluation. Whole exome sequencing demonstrated a novel homozygous frameshift mutation in CUL7, one of the causative genes of 3-M syndrome. We discuss the utility of exome sequencing in diagnosing rare disorders. ...[more]

PMID: 22974575

Similar Datasets

Whole Exome Sequencing Reveals a XPNPEP3 Novel Mutation Causing Nephronophthisis in a Pediatric Patient

Project description:Background:Nephronophthisis (NPHP) is a progressive tubulointestinal kidney condition that demonstrates an AR inheritance pattern. Up to now, more than 20 various genes have been detected for NPHP, with NPHP1 as the first one detected. X-prolyl aminopeptidase 3 (XPNPEP3) mutation is related to NPHP-like 1 nephropathy and late onset NPHP. Methods:The proband (index patient) had polyuria, polydipsia and chronic kidney disease and was clinically suspected of NPHP. After the collection of blood sample from proband and her parents, whole exome sequencing (WES) was performed to identify the possible variants in the proband from a consanguineous marriage. The functional importance of variants was estimated by bioinformatic analysis. In the affected proband and her parents, Sanger sequencing was conducted for variants’ confirmation and segregation analysis. Results:Clinical and paraclinical investigations of the patient was not informative. Using WES, we could detect a novel homozygous frameshift mutation in XPNPEP3 (NM_022098.2: c.719_720insA; p. Q241Tfs*13), and by Sanger sequencing, we demonstrated an insertion in XPNPEP3. Conclusion:The homozygous genotype of the novel p.Q241Tfs*31 variant in XPNPEP3 may cause NPHP in the early childhood age.

| S-EPMC7601541 | biostudies-literature

Whole-exome sequencing in undiagnosed genetic diseases: interpreting 119 trios.

Project description:PurposeDespite the recognized clinical value of exome-based diagnostics, methods for comprehensive genomic interpretation remain immature. Diagnoses are based on known or presumed pathogenic variants in genes already associated with a similar phenotype. Here, we extend this paradigm by evaluating novel bioinformatics approaches to aid identification of new gene-disease associations.MethodsWe analyzed 119 trios to identify both diagnostic genotypes in known genes and candidate genotypes in novel genes. We considered qualifying genotypes based on their population frequency and in silico predicted effects we also characterized the patterns of genotypes enriched among this collection of patients.ResultsWe obtained a genetic diagnosis for 29 (24%) of our patients. We showed that patients carried an excess of damaging de novo mutations in intolerant genes, particularly those shown to be essential in mice (P = 3.4 × 10(-8)). This enrichment is only partially explained by mutations found in known disease-causing genes.ConclusionThis work indicates that the application of appropriate bioinformatics analyses to clinical sequence data can also help implicate novel disease genes and suggest expanded phenotypes for known disease genes. These analyses further suggest that some cases resolved by whole-exome sequencing will have direct therapeutic implications.

| S-EPMC4791490 | biostudies-literature

Whole Exome Sequencing Reveals a BSCL2 Mutation Causing Progressive Encephalopathy with Lipodystrophy (PELD) in an Iranian Pediatric Patient.

Project description:BackgroundProgressive encephalopathy with or without lipodystrophy is a rare autosomal recessive childhood-onset seipin-associated neurodegenerative syndrome, leading to developmental regression of motor and cognitive skills. In this study, we introduce a patient with developmental regression and autism. The causative mutation was found by exome sequencing.MethodsThe proband showed a generalized hypertonia and regression of all developmental milestones. Based on the advantages of next-generation sequencing (NGS), whole exome sequencing (WES) was requested. The functional significance of variants was evaluated by NGS-specific prediction servers. Sanger sequencing was used for segregation analysis in the family.ResultsThere was no specific sign in the clinical and paraclinical investigations of the patient to establish a conclusive clinical diagnosis. WES detected a known homozygous nonsense mutation in BSCL2 (NM_001122955.3:c. 985C>T; p.Arg329*). The variant is segregating in the pedigree with an autosomal recessive pattern.ConclusionExome sequencing is a robust method for identifying the candidate gene variants in Mendelian traits.

| S-EPMC5075143 | biostudies-literature

Whole exome sequencing for a patient with Rubinstein-Taybi syndrome reveals de novo variants besides an overt CREBBP mutation.

Project description:Rubinstein-Taybi syndrome (RSTS) is a rare condition with a prevalence of 1 in 125,000-720,000 births and characterized by clinical features that include facial, dental, and limb dysmorphology and growth retardation. Most cases of RSTS occur sporadically and are caused by de novo mutations. Cytogenetic or molecular abnormalities are detected in only 55% of RSTS cases. Previous genetic studies have yielded inconsistent results due to the variety of methods used for genetic analysis. The purpose of this study was to use whole exome sequencing (WES) to evaluate the genetic causes of RSTS in a young girl presenting with an Autism phenotype. We used the Autism diagnostic observation schedule (ADOS) and Autism diagnostic interview revised (ADI-R) to confirm her diagnosis of Autism. In addition, various questionnaires were used to evaluate other psychiatric features. We used WES to analyze the DNA sequences of the patient and her parents and to search for de novo variants. The patient showed all the typical features of Autism, WES revealed a de novo frameshift mutation in CREBBP and de novo sequence variants in TNC and IGFALS genes. Mutations in the CREBBP gene have been extensively reported in RSTS patients, while potential missense mutations in TNC and IGFALS genes have not previously been associated with RSTS. The TNC and IGFALS genes are involved in central nervous system development and growth. It is possible for patients with RSTS to have additional de novo variants that could account for previously unexplained phenotypes.

| S-EPMC4394500 | biostudies-literature

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

Project description:BACKGROUND:3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS:Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS:We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION:These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

| S-EPMC7370744 | biostudies-literature

Concordance between whole-exome sequencing and clinical Sanger sequencing: implications for patient care.

Project description:The clinical translation of next-generation sequencing has created a paradigm shift in the diagnostic assessment of individuals with suspected rare genetic diseases. Whole-exome sequencing (WES) simultaneously examines the majority of the coding portion of the genome and is rapidly becoming accepted as an efficient alternative to clinical Sanger sequencing for diagnosing genetically heterogeneous disorders. Among reports of the clinical and diagnostic utility of WES, few studies to date have directly compared its concordance to Sanger sequencing, which is considered the clinical "gold standard". We performed a direct comparison of 391 coding and noncoding polymorphisms and variants of unknown significance identified by clinical Sanger sequencing to the WES results of 26 patients. Of the 150 well-covered coding variants identified by Sanger sequencing, 146 (97.3%) were also reported by WES. Nine genes were excluded from the comparison due to consistently low coverage in WES, which might be attributed to the use of older exome capture kits. We performed confirmatory Sanger sequencing of discordant variants; including five variants with discordant bases and four with discordant zygosity. Confirmatory Sanger sequencing supported the original Sanger report for three of the five discordant bases, one was shown to be a false positive supporting the WES data, and one result differed from both the Sanger and WES data. Two of the discordant zygosity results supported Sanger and the other two supported WES data. We report high concordance for well-covered coding variants, supporting the use of WES as a screening tool for heterogeneous disorders, and recommend the use of supplementary Sanger sequencing for poorly-covered genes when the clinical suspicion is high. Importantly, despite remaining difficulties with achieving complete coverage of the whole exome, 10 (38.5%) of the 26 compared patients were diagnosed through WES.

| S-EPMC5023935 | biostudies-other

Whole-exome sequencing identified a homozygous BRDT mutation in a patient with acephalic spermatozoa.

Project description:Acephalic spermatozoa is a very rare disorder of male infertility. Here, in a patient from from a consanguineous family, we have identified, by whole-exome sequencing, a homozygous mutation (c.G2783A, p.G928D) in the BRDT gene. The gene product, BRDT, is a testis-specific protein that is considered an important drug target for male contraception. The G928D mutation is in the P-TEFb binding domain, which mediates the interaction with transcription elongation factor and might affect the transcriptional activities of downstream genes. By RNA-sequencing analysis of cells expressing the BRDT mutation, we found the p.G928D mutation protein causes mis-regulation of 899 genes compared with BRDT wild-type cells. Furthermore, by Gene Ontology analysis, the upregulated genes in p.G928D cells were enriched in the processes of intracellular transport, RNA splicing, cell cycle and DNA metabolic process, revealing the underlying mechanism of the pathology that leads to acephalic spermatozoa.

| S-EPMC5386733 | biostudies-literature

Whole-exome sequencing of a patient with severe and complex hemostatic abnormalities reveals a possible contributing frameshift mutation in C3AR1.

Project description:The increasing availability of genome-wide analysis has made it possible to rapidly sequence the exome of patients with undiagnosed or unresolved medical conditions. Here, we present the case of a 64-yr-old male patient with schistocytes in the peripheral blood smear and a complex and life-threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based on this finding, atypical hemolytic uremic syndrome was suspected because of a genetic predisposition, and a targeted treatment regime with eculizumab was initiated. Life-threatening hemostatic abnormalities would most likely have persisted had it not been for the implementation of whole-exome sequencing in this particular clinical setting.

| S-EPMC4990812 | biostudies-literature

Mutation discovery in mice by whole exome sequencing.

Project description:We report the development and optimization of reagents for in-solution, hybridization-based capture of the mouse exome. By validating this approach in a multiple inbred strains and in novel mutant strains, we show that whole exome sequencing is a robust approach for discovery of putative mutations, irrespective of strain background. We found strong candidate mutations for the majority of mutant exomes sequenced, including new models of orofacial clefting, urogenital dysmorphology, kyphosis and autoimmune hepatitis.

| S-EPMC3308049 | biostudies-literature

Whole exome sequencing reveals EP300 mutation in mildly affected female: expansion of the spectrum.

Project description:Rubinstein-Taybi syndrome is associated with intellectual and physical features. CREBBP and EP300 are causative. Few cases of EP300 mutations are reported. We report a case with mild features of RSTS and EP300 mutation on exome sequencing. This illustrates the utility of exome sequencing to expand every genetic phenotype.

| S-EPMC4929809 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data