Dataset Information

Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.

ABSTRACT: The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ?bioR ?bioBFDA mutant), the ?-galactosidase (?-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of expression of bioY and bio operons that separately function in biotin transport and the biosynthesis pathway.

SUBMITTER: Feng Y

PROVIDER: S-EPMC3719536 | biostudies-literature | 2013 Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.

Feng Youjun Y Xu Jie J Zhang Huimin H Chen Zeliang Z Srinivas Swaminath S

Journal of bacteriology 20130531 15

The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that ca ...[more]

PMID: 23729648

Similar Datasets

Project description:Biotin is essential for the growth and pathogenicity of microorganisms. Damage to biotin biosynthesis results in impaired bacterial growth and decreased virulence in vivo. However, the mechanisms of biotin biosynthesis in Riemerella anatipestifer remain unclear. In this study, two R. anatipestifer genes associated with biotin biosynthesis were identified. AS87_RS05840 encoded a BirA protein lacking the N-terminal winged helix-turn-helix DNA binding domain, identifying it as a group I biotin protein ligase, and AS87_RS09325 encoded a BioX protein, which was in the helix-turn-helix xenobiotic response element family of transcription factors. Electrophoretic mobility shift assays demonstrated that BioX bound to the promoter region of bioF. In addition, the R. anatipestifer genes bioF (encoding 7-keto-8-aminopelargonic acid synthase), bioD (encoding dethiobiotin synthase), and bioA (encoding 7,8-diaminopelargonic acid synthase) were in an operon and were regulated by BioX. Quantitative reverse transcription-PCR showed that transcription of the bioFDA operon increased in the mutant Yb2ΔbioX in the presence of excessive biotin, compared with that in the wild-type strain Yb2, suggesting that BioX acted as a repressor of biotin biosynthesis. Streptavidin blot analysis showed that BirA caused biotinylation of BioX, indicating that biotinylated BioX was involved in metabolic pathways. Moreover, as determined by the median lethal dose, the virulence of Yb2ΔbioX was attenuated 500-fold compared with that of Yb2. To summarize, the genes birA and bioX were identified in R. anatipestifer, and BioX was found to act as a repressor of the bioFDA operon involved in the biotin biosynthesis pathway and identified as a bacterial virulence factor. IMPORTANCE Riemerella anatipestifer is a causative agent of diseases in ducks, geese, turkeys, and various other domestic and wild birds. Our study reveals that biotin synthesis of R. anatipestifer is regulated by the BioX through binding to the promoter region of the bioF gene to inhibit transcription of the bioFDA operon. Moreover, bioX is required for R. anatipestifer pathogenicity, suggesting that BioX is a potential target for treatment of the pathogen. R. anatipestifer BioX has thus been identified as a novel negative regulator involved in biotin metabolism and associated with bacterial virulence in this study.

Project description:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in ?-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by ?-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven ?-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

Dataset Information

Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.

Publications

Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets