Therapeutic expression of hairpins targeting apolipoprotein B100 induces phenotypic and transcriptome changes in murine liver.
Ontology highlight
ABSTRACT:
SUBMITTER: Maczuga P
PROVIDER: S-EPMC3881031 | biostudies-literature | 2014 Jan
REPOSITORIES: biostudies-literature
Publications
Therapeutic expression of hairpins targeting apolipoprotein B100 induces phenotypic and transcriptome changes in murine liver.
Maczuga P P Verheij J J van der Loos C C van Logtenstein R R Hooijer G G Martier R R Borel F F Lubelski J J Koornneef A A Blits B B van Deventer S S Petry H H Konstantinova P P
Gene therapy 20131024 1
Constitutive expression of short hairpin RNAs (shRNAs) may cause cellular toxicity in vivo and using microRNA (miRNA) scaffolds can circumvent this problem. Previously, we have shown that embedding small interfering RNA sequences targeting apolipoprotein B100 (ApoB) in shRNA (shApoB) or miRNA (miApoB) scaffolds resulted in differential processing and long-term efficacy in vivo. Here we show that adeno-associated virus (AAV)-shApoB- or AAV-miApoB-mediated ApoB knockdown induced differential liver ...[more]
Similar Datasets
Project description:RATIONALE:Genome-wide association studies identified single-nucleotide polymorphisms near the SORT1 locus strongly associated with decreased plasma LDL-C (low-density lipoprotein cholesterol) levels and protection from atherosclerotic cardiovascular disease and myocardial infarction. The minor allele of the causal SORT1 single-nucleotide polymorphism locus creates a putative C/EBP? (CCAAT/enhancer-binding protein ?)-binding site in the SORT1 promoter, thereby increasing in homozygotes sortilin expression by 12-fold in liver, which is rich in this transcription factor. Our previous studies in mice have showed reductions in plasma LDL-C and its principal protein component, apoB (apolipoprotein B) with increased SORT1 expression, and in vitro studies suggested that sortilin promoted the presecretory lysosomal degradation of apoB associated with the LDL precursor, VLDL (very-low-density lipoprotein). OBJECTIVE:To determine directly that SORT1 overexpression results in apoB degradation and to identify the mechanisms by which this reduces apoB and VLDL secretion by the liver, thereby contributing to understanding the clinical phenotype of lower LDL-C levels. METHODS AND RESULTS:Pulse-chase studies directly established that SORT1 overexpression results in apoB degradation. As noted above, previous work implicated a role for lysosomes in this degradation. Through in vitro and in vivo studies, we now demonstrate that the sortilin-mediated route of apoB to lysosomes is unconventional and intersects with autophagy. Increased expression of sortilin diverts more apoB away from secretion, with both proteins trafficking to the endosomal compartment in vesicles that fuse with autophagosomes to form amphisomes. The amphisomes then merge with lysosomes. Furthermore, we show that sortilin itself is a regulator of autophagy and that its activity is scaled to the level of apoB synthesis. CONCLUSIONS:These results strongly suggest that an unconventional lysosomal targeting process dependent on autophagy degrades apoB that was diverted from the secretory pathway by sortilin and provides a mechanism contributing to the reduced LDL-C found in individuals with SORT1 overexpression.
| S-EPMC5815905 | biostudies-literature
Project description:Mipomersen is a 20mer antisense oligonucleotide (ASO) that inhibits apolipoprotein B (apoB) synthesis; its low-density lipoprotein (LDL)-lowering effects should therefore result from reduced secretion of very-low-density lipoprotein (VLDL). We enrolled 17 healthy volunteers who received placebo injections weekly for 3 weeks followed by mipomersen weekly for 7 to 9 weeks. Stable isotopes were used after each treatment to determine fractional catabolic rates and production rates of apoB in VLDL, IDL (intermediate-density lipoprotein), and LDL, and of triglycerides in VLDL. Mipomersen significantly reduced apoB in VLDL, IDL, and LDL, which was associated with increases in fractional catabolic rates of VLDL and LDL apoB and reductions in production rates of IDL and LDL apoB. Unexpectedly, the production rates of VLDL apoB and VLDL triglycerides were unaffected. Small interfering RNA-mediated knockdown of apoB expression in human liver cells demonstrated preservation of apoB secretion across a range of apoB synthesis. Titrated ASO knockdown of apoB mRNA in chow-fed mice preserved both apoB and triglyceride secretion. In contrast, titrated ASO knockdown of apoB mRNA in high-fat-fed mice resulted in stepwise reductions in both apoB and triglyceride secretion. Mipomersen lowered all apoB lipoproteins without reducing the production rate of either VLDL apoB or triglyceride. Our human data are consistent with long-standing models of posttranscriptional and posttranslational regulation of apoB secretion and are supported by in vitro and in vivo experiments. Targeting apoB synthesis may lower levels of apoB lipoproteins without necessarily reducing VLDL secretion, thereby lowering the risk of steatosis associated with this therapeutic strategy.
| S-EPMC4944115 | biostudies-literature
Project description:Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5' and 3' cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 10(11) genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics.
| S-EPMC3538299 | biostudies-literature
Project description:BackgroundControlling and limiting the expression of short hairpin RNA (shRNA) by using constitutive or tissue-specific polymerase II (pol II) expression can be a promising strategy to avoid RNAi toxicity. However, to date detailed studies on requirements for effective pol II shRNA expression and processing are not available. We investigated the optimal structural configuration of shRNA molecules, namely: hairpin location, stem length and termination signal required for effective pol II expression and compared it with an alternative strategy of avoiding toxicity by using artificial microRNA (miRNA) scaffolds.ResultsHighly effective shRNAs targeting luciferase (shLuc) or Apolipoprotein B100 (shApoB1 and shApoB2) were placed under the control of the pol II CMV promoter and expressed at +5 or +6 nucleotides (nt) with reference to the transcription start site (TSS). Different transcription termination signals (TTS), namely minimal polyadenylation (pA), poly T (T5) and U1 were also used. All pol II- expressed shRNA variants induced mild inhibition of Luciferase reporters carrying specific targets and none of them showed comparable efficacy to their polymerase III-expressed H1-shRNA controls, regardless of hairpin position and termination signal used. Extending hairpin stem length from 20 basepairs (bp) to 21, 25 or 29 bp yielded only slight improvement in the overall efficacy. When shLuc, shApoB1 and shApoB2 were placed in an artificial miRNA scaffold, two out of three were as potent as the H1-shRNA controls. Quantification of small interfering RNA (siRNA) molecules showed that the artificial miRNA constructs expressed less molecules than H1-shRNAs and that CMV-shRNA expressed the lowest amount of siRNA molecules suggesting that RNAi processing in this case is least effective. Furthermore, CMV-miApoB1 and CMV-miApoB2 were as effective as the corresponding H1-shApoB1 and H1-shApoB2 in inhibiting endogenous ApoB mRNA.ConclusionOur results demonstrate that artificial miRNA have a better efficacy profile than shRNA expressed either from H1 or CMV promoter and will be used in the future for RNAi therapeutic development.
| S-EPMC3424168 | biostudies-literature
Project description:Purpose: Identical predicted small interfering RNA (siRNA) sequences targeting Apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct compariso of the possible aspecific off-target effects in vivo was performed. Next generation sequencing (NGS) of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5’ and 3’ cleavage sites and abundance of the guide or passenger strands. Methods [1]: Total liver RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturer’s protocol. Each read file (sample), in the FASTQ format, was individually aligned against the mouse reference genome (15 May 2012 NCBI build 38.1) using CLC Bio-Genomic Workbench and the expression abundance for each gene (RPKM) was calculated according to Montazavi et al. Result [1]s: Based on our previous observations that shApoB and miApoB are differentially processed and that miApoB has a different passenger, we checked for possible aspecific off-target effects in vivo. NGS liver transcriptome analysis was performed 8 weeks p.i. for animals injected with 1x1011 gc AAV encoding shScr, shApoB, miScr and miApoB. We investigated whether shApoB and miApoB processing differences translate into differences in gene expression in injected animals. A total number of 266 genes were significantly changing (p <0,05) in miApoB-injected mice compared to miScr. Additionally 106 genes were found to be significantly up or down-regulated in the shApoB mice compared to shScr. Off-target predictions using Smith-Waterman algorithm for the most abundant guide and passenger strand variants were performed to investigate if any of the observed changes results from aspecific interactions. None of the changing genes had predicted targets for the guide or passenger strands of shApoB or miApoB. Conclusions [1]: An important observation is that none of the changes in gene expression in AAV-miApoB and AAV-shApoB can be explained by possible aspecific down-regulation of non-target transcripts. Methods [2]: For NGS analysis cells were transfected with 4 µg shApoB- or miApoB-expression plasmids using Lipofectamine 2000 reagent and total RNA was isolated from cells 48 hr post-transfection using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. Total RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturer’s protocol. The NGS small RNA raw data set was analyzed using the CLC_bio genomic workbench (CLC Bio, Aarhus, Denmark). The obtained reads were adaptor-trimmed, which decreased the average read size from ~36bp to ~25bp. The custom adapter sequenced used for trimming all the bases extending 5’ was: GTGACTGGAGTTCC-TTGGCACCCGAGAATTCCA. All reads containing ambiguity N symbols, reads shorter than 15 nt, longer than 55 nt in length and reads represented less than 10 times were discarded. Next, both data sets from shApoB and miApoB samples were grouped based on the match to the reference sequence and the obtained unique small RNAs were aligned to the sequence of pre-miApoB: GATCCTGGAGGCTTGC-TGAAGGCTGTATGCTGATGGACAGGTCAATCAATCTTGTTTTGGCCACTGACTGACAAGATTGAGACCTGTCCATCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCAG or shApoB: GATCCCCGATTGATTGACCTGTCCATTTCAAGAGAATGGACAGGTCAATCAATC-TTTTTCAGCTT sequence, respectively. To relatively represent the expression counts for the small RNAs obtained in the experiment, reads per million (rpm) or percentage of reads based on the total number of reads matching the reference shApoB or miApoB sequence were calculated Results [2]: The small RNAs were aligned against their reference sequence resulting in 541.939 reads matching shApoB and 1.525.211 reads matching miApoB (Fig S1 and S2). Analysis of the length distribution of the reads indicated that siApoB guide strand originating from shApoB ranged between 19 and 23 nt, with the most abundant one being 21 nt-long. Surprisingly, siApoB guide from miApoB scaffold ranged from 23 to 25 nt with the 24 nt-long strand being the predominant variant. This finding was rather unexpected considering that the predicted guide strand of siApoB was 21 nt long for both shApoB and miApoB scaffolds. Analysis of the processed 5’ ends of the siApoB guide strand indicated that most of the reads matched position +1 relative to the predicted cleavage site for shApoB, while all the reads matched position 0 for miApoB. The 3’ ends of the siApoB guide strand had a more heterogeneous pattern and ranged from -1 to +3 for shApoB and +1 to +4 for miApoB. Next, we looked at the sequence distribution and percentage of reads for both the guide and passenger siApoB strands originating from the shApoB and miApoB scaffolds. A substantial difference between the two is that the guide from shApoB is in the 3’ arm and hence Dicer or other endonuclease defines the cleavage position while the guide is present in the 5’ arm of miApoB, where Drosha defines the cleavage. Thus, defining the length and exact cleavage position for the guide and passenger strands is very important since even single nucleotide differences may result in significant changes in the predicted targets of the siRNAs. Moreover, the passenger siRNA* strand, if not degraded efficiently, may bind to unanticipated targets and cause off-target effects. As expected, 44.4% of the reads originating from shApoB matched the siApoB guide strand but processing was shifted at position +1 (Fig. 2d, upper panel). Surprisingly only 12.1% of the reads matched perfectly the predicted siApoB guide strand of 21 nt and starting at position 0. The reads matching the passenger siApoB* strand were represented in much lower percentage with the predominant one being only 5.3%. Analysis of the guide strand from the siApoB reads originating from the miApoB scaffold indicated that they all started at the predicted cleavage site. Surprisingly, the predominant, 22.3% of reads were 24 nt-long. Furthermore 5.1% reads were 23 nt- and 1.9% were 25 nt-long. A substantial number of 62% of the reads was found matching the passenger siApoB* strand and ranged between 20 and 22 nt in length. In conclusion, both shApoB and miApoB scaffolds did not yield the predicted siApoB guide or siApoB* passenger sequences after processing from the cellular RNAi machinery. The guide from miApoB was cleaved much more precisely by Drosha at its 5’ end compared to shApoB that gave more heterogeneous pools of sequences following processing. Conclusions[2]: An unexpected discovery in the current study was that siRNA processing by the cellular RNAi machinery did not follow the generally accepted and described cleavage sites for both molecules shApoB and miApoB siApoB guide strand originating from the shApoB scaffold was more heterogeneous in cleavage sites and length compared to the product originating from the miApoB scaffold. Most likely, differential cleavage mechanism defined the heterogeneity in the guide and passenger strands. Additionally, shRNAs with 19 bp stem or less are not necessarily recognized by Dicer and maybe be processed differently. The heterogeneity seen with the shApoB can also be explained by the potential for 2 or 3 uridines to be added following termination of pol III transcription. The main pool of guide sequences originating from miApoB was 24 nt-long although we used the scaffold of cellular pri-mir-155 that produces a 23 nt mature miRNA. However, a 24 nt-long siApoB sequence did not compromise efficacy because when placed in the miApoB scaffold, the ApoB target sequence was extended at the 3’ end with 4 nt until the loop. Another important observation is that the siApoB*
2012-07-10 | GSE39187 | GEO
Project description:A number of studies have reported an association between increased levels of antibodies against oxidized low-density lipoprotein (oxLDL) and cardiovascular disease, but the anti-oxLDL antibody has not been confirmed to serve as an effective biomarker for prediction of acute myocardial infarction (AMI). Apolipoprotein B100 (ApoB100)-derived peptide fragments generated by proteolytic degradation and aldehyde modification are the major antigens in oxLDL, and so the present work was undertaken to detect circulating IgG for Apo-B100-derived peptide antigens. An in-house enzyme-linked immunosorbent assay (ELISA) was developed with eight ApoB100-derived peptide antigens (Ag1-Ag8) to detect circulating anti-ApoB100 IgG levels in 267 patients with AMI and 201 control subjects. Binary logistic regression analysis revealed that circulating IgG for Ag1 was significantly higher in the patient group than the control group (P < 0.001) after adjustment for age, gender, smoking, hypertension, diabetes and circulating levels of cholesterol, HDL, LDL, ApoA and ApoB100. None of the other seven antigens detected an increase in IgG levels in AMI patients compared with control subjects. Spearman correlation analysis showed no correlation between IgG antibody for Ag1 and clinical characteristics. In conclusion, the linear peptide antigens derived from ApoB100 may be suitable for the development of an ELISA antibody test for prediction of AMI, although further confirmation is still needed in large-scale clinical studies.
| S-EPMC4564368 | biostudies-literature
Project description:Glucosamine impairs hepatic apolipoprotein B100 (apoB100) production by inducing endoplasmic reticulum (ER) stress and enhancing cotranslational and posttranslational apoB100 degradation (Qiu, W., R. K. Avramoglu, A. C. Rutledge, J. Tsai, and K. Adeli. Mechanisms of glucosamine-induced suppression of the hepatic assembly and secretion of apolipoprotein B-100-containing lipoproteins. J. Lipid Res. 2006. 47: 1749-1761). Here, we report that glucosamine also regulates apoB100 protein synthesis via ER-stress-induced PERK activation. Short-term (4 h) glucosamine treatment of HepG2 cells reduced both cellular (by 62%) and secreted apoB100 (by 43%) without altering apoB100 mRNA. Treatment with proteasomal inhibitors only partially prevented the suppressive effects of glucosamine, suggesting that mechanisms other than proteasomal degradation may also be involved. Glucosamine-induced ER stress was associated with a significantly reduced apoB100 synthesis with no significant change in posttranslational decay rates, suggesting that glucosamine exerted its effect early during apoB biosynthesis. The role of PERK and its substrate, alpha-subunit of eukaryotic initiation factor 2 (eIF2alpha), in the suppressive effects of glucosamine on apoB synthesis was then investigated. Coexpression of apoB15 (normally resistant to intracellular degradation) with wild-type double stranded (ds) RNA activated protein kinase (PKR)-like endoplasmic reticulum kinase (PERK) in COS-7 cells resulted in a dramatic reduction in the levels of newly synthesized apoB15. Interestingly, cotransfection with apoB15 and a kinase inactive PERK mutant (K618A) increased apoB15 expression. In addition, short-term glucosamine treatment stimulated an increase in phosphorylation of PERK and eIF2alpha. Taken together, these data suggest that in addition to the induction of ER-associated degradation and other degradative pathways, ER stress is associated with suppression of apoB synthesis via a PERK-dependent mechanism.
| S-EPMC2724794 | biostudies-literature
Project description:Purpose: Identical predicted small interfering RNA (siRNA) sequences targeting Apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct compariso of the possible aspecific off-target effects in vivo was performed. Next generation sequencing (NGS) of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5M-bM-^@M-^Y and 3M-bM-^@M-^Y cleavage sites and abundance of the guide or passenger strands. Methods [1]: Total liver RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturerM-bM-^@M-^Ys protocol. Each read file (sample), in the FASTQ format, was individually aligned against the mouse reference genome (15 May 2012 NCBI build 38.1) using CLC Bio-Genomic Workbench and the expression abundance for each gene (RPKM) was calculated according to Montazavi et al. Result [1]s: Based on our previous observations that shApoB and miApoB are differentially processed and that miApoB has a different passenger, we checked for possible aspecific off-target effects in vivo. NGS liver transcriptome analysis was performed 8 weeks p.i. for animals injected with 1x1011 gc AAV encoding shScr, shApoB, miScr and miApoB. We investigated whether shApoB and miApoB processing differences translate into differences in gene expression in injected animals. A total number of 266 genes were significantly changing (p <0,05) in miApoB-injected mice compared to miScr. Additionally 106 genes were found to be significantly up or down-regulated in the shApoB mice compared to shScr. Off-target predictions using Smith-Waterman algorithm for the most abundant guide and passenger strand variants were performed to investigate if any of the observed changes results from aspecific interactions. None of the changing genes had predicted targets for the guide or passenger strands of shApoB or miApoB. Conclusions [1]: An important observation is that none of the changes in gene expression in AAV-miApoB and AAV-shApoB can be explained by possible aspecific down-regulation of non-target transcripts. Methods [2]: For NGS analysis cells were transfected with 4 M-BM-5g shApoB- or miApoB-expression plasmids using Lipofectamine 2000 reagent and total RNA was isolated from cells 48 hr post-transfection using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturerM-bM-^@M-^Ys protocol. Total RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturerM-bM-^@M-^Ys protocol. The NGS small RNA raw data set was analyzed using the CLC_bio genomic workbench (CLC Bio, Aarhus, Denmark). The obtained reads were adaptor-trimmed, which decreased the average read size from ~36bp to ~25bp. The custom adapter sequenced used for trimming all the bases extending 5M-bM-^@M-^Y was: GTGACTGGAGTTCC-TTGGCACCCGAGAATTCCA. All reads containing ambiguity N symbols, reads shorter than 15 nt, longer than 55 nt in length and reads represented less than 10 times were discarded. Next, both data sets from shApoB and miApoB samples were grouped based on the match to the reference sequence and the obtained unique small RNAs were aligned to the sequence of pre-miApoB: GATCCTGGAGGCTTGC-TGAAGGCTGTATGCTGATGGACAGGTCAATCAATCTTGTTTTGGCCACTGACTGACAAGATTGAGACCTGTCCATCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCAG or shApoB: GATCCCCGATTGATTGACCTGTCCATTTCAAGAGAATGGACAGGTCAATCAATC-TTTTTCAGCTT sequence, respectively. To relatively represent the expression counts for the small RNAs obtained in the experiment, reads per million (rpm) or percentage of reads based on the total number of reads matching the reference shApoB or miApoB sequence were calculated Results [2]: The small RNAs were aligned against their reference sequence resulting in 541.939 reads matching shApoB and 1.525.211 reads matching miApoB (Fig S1 and S2). Analysis of the length distribution of the reads indicated that siApoB guide strand originating from shApoB ranged between 19 and 23 nt, with the most abundant one being 21 nt-long. Surprisingly, siApoB guide from miApoB scaffold ranged from 23 to 25 nt with the 24 nt-long strand being the predominant variant. This finding was rather unexpected considering that the predicted guide strand of siApoB was 21 nt long for both shApoB and miApoB scaffolds. Analysis of the processed 5M-bM-^@M-^Y ends of the siApoB guide strand indicated that most of the reads matched position +1 relative to the predicted cleavage site for shApoB, while all the reads matched position 0 for miApoB. The 3M-bM-^@M-^Y ends of the siApoB guide strand had a more heterogeneous pattern and ranged from -1 to +3 for shApoB and +1 to +4 for miApoB. Next, we looked at the sequence distribution and percentage of reads for both the guide and passenger siApoB strands originating from the shApoB and miApoB scaffolds. A substantial difference between the two is that the guide from shApoB is in the 3M-bM-^@M-^Y arm and hence Dicer or other endonuclease defines the cleavage position while the guide is present in the 5M-bM-^@M-^Y arm of miApoB, where Drosha defines the cleavage. Thus, defining the length and exact cleavage position for the guide and passenger strands is very important since even single nucleotide differences may result in significant changes in the predicted targets of the siRNAs. Moreover, the passenger siRNA* strand, if not degraded efficiently, may bind to unanticipated targets and cause off-target effects. As expected, 44.4% of the reads originating from shApoB matched the siApoB guide strand but processing was shifted at position +1 (Fig. 2d, upper panel). Surprisingly only 12.1% of the reads matched perfectly the predicted siApoB guide strand of 21 nt and starting at position 0. The reads matching the passenger siApoB* strand were represented in much lower percentage with the predominant one being only 5.3%. Analysis of the guide strand from the siApoB reads originating from the miApoB scaffold indicated that they all started at the predicted cleavage site. Surprisingly, the predominant, 22.3% of reads were 24 nt-long. Furthermore 5.1% reads were 23 nt- and 1.9% were 25 nt-long. A substantial number of 62% of the reads was found matching the passenger siApoB* strand and ranged between 20 and 22 nt in length. In conclusion, both shApoB and miApoB scaffolds did not yield the predicted siApoB guide or siApoB* passenger sequences after processing from the cellular RNAi machinery. The guide from miApoB was cleaved much more precisely by Drosha at its 5M-bM-^@M-^Y end compared to shApoB that gave more heterogeneous pools of sequences following processing. Conclusions[2]: An unexpected discovery in the current study was that siRNA processing by the cellular RNAi machinery did not follow the generally accepted and described cleavage sites for both molecules shApoB and miApoB siApoB guide strand originating from the shApoB scaffold was more heterogeneous in cleavage sites and length compared to the product originating from the miApoB scaffold. Most likely, differential cleavage mechanism defined the heterogeneity in the guide and passenger strands. Additionally, shRNAs with 19 bp stem or less are not necessarily recognized by Dicer and maybe be processed differently. The heterogeneity seen with the shApoB can also be explained by the potential for 2 or 3 uridines to be added following termination of pol III transcription. The main pool of guide sequences originating from miApoB was 24 nt-long although we used the scaffold of cellular pri-mir-155 that produces a 23 nt mature miRNA. However, a 24 nt-long siApoB sequence did not compromise efficacy because when placed in the miApoB scaffold, the ApoB target sequence was extended at the 3M-bM-^@M-^Y end with 4 nt until the loop. Another important observation is that the siApoB* Liver mRNA profiles of C57BL/6 9 weeks after intravenous AAV injection of 1x1011 gc per animal (~4x1012 gc/kg) of AAV-shRNA, AAV-miRNA or PBS via the tail vein. Next Generation Sequencing on Illumina platform
2012-07-10 | E-GEOD-39187 | biostudies-arrayexpress
Project description:One of the primary genetic risk factors for Alzheimer's disease (AD) is the presence of the ?4 allele of apolipoprotein E (APOE). APOE is a polymorphic lipoprotein that is a major cholesterol carrier in the brain. It is also involved in various cellular functions such as neuronal signaling, neuroinflammation and glucose metabolism. Humans predominantly possess three different allelic variants of APOE, termed E2, E3, and E4, with the E3 allele being the most common. The presence of the E4 allele is associated with increased risk of AD whereas E2 reduces the risk. To understand the molecular mechanisms that underlie APOE-related genetic risk, considerable effort has been devoted towards developing cellular and animal models. Data from these models indicate that APOE4 exacerbates amyloid ? plaque burden in a dose-dependent manner. and may also enhance tau pathogenesis in an isoform-dependent manner. Other studies have suggested APOE4 increases the risk of AD by mechanisms that are distinct from modulation of A? or tau pathology. Further, whether plasma APOE, by influencing systemic metabolic pathways, can also possibly alter CNS function indirectly is not complete;y understood. Collectively, the available studies suggest that APOE may impact multiple signaling pathways and thus investigators have sought therapeutics that would disrupt pathological functions of APOE while preserving or enhancing beneficial functions. This review will highlight some of the therapeutic strategies that are currently being pursued to target APOE4 towards preventing or treating AD and we will discuss additional strategies that holds promise for the future.
| S-EPMC6995170 | biostudies-literature
Project description:Elevated lipoprotein (a) [Lp(a)] levels increase the risk for CVD. Novel treatments that decrease LDL cholesterol (LDL-C) have also shown promise for reducing Lp(a) levels. Mipomersen, an antisense oligonucleotide that inhibits apoB synthesis, is approved for the treatment of homozygous familial hypercholesterolemia. It decreases plasma levels of LDL-C by 25% to 39% and lowers levels of Lp(a) by 21% to 39%. We examined the mechanisms for Lp(a) lowering during mipomersen treatment. We enrolled 14 healthy volunteers who received weekly placebo injections for 3 weeks followed by weekly injections of mipomersen for 7 weeks. Stable isotope kinetic studies were performed using deuterated leucine at the end of the placebo and mipomersen treatment periods. The fractional catabolic rate (FCR) of Lp(a) was determined from the enrichment of a leucine-containing peptide specific to apo(a) by LC/MS. The production rate (PR) of Lp(a) was calculated from the product of Lp(a) FCR and Lp(a) concentration (converted to pool size). In a diverse population, mipomersen reduced plasma Lp(a) levels by 21%. In the overall study group, mipomersen treatment resulted in a 27% increase in the FCR of Lp(a) with no significant change in PR. However, there was heterogeneity in the response to mipomersen therapy, and changes in both FCRs and PRs affected the degree of change in Lp(a) concentrations. Mipomersen treatment decreases Lp(a) plasma levels mainly by increasing the FCR of Lp(a), although changes in Lp(a) PR were significant predictors of reductions in Lp(a) levels in some subjects.
| S-EPMC6277161 | biostudies-literature