Dataset Information

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

ABSTRACT: The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.

SUBMITTER: Aranda J

PROVIDER: S-EPMC3889614 | biostudies-literature | 2013 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

Aranda Jesús J Poza Margarita M Shingu-Vázquez Miguel M Cortés Pilar P Boyce John D JD Adler Ben B Barbé Jordi J Bou Germán G

Journal of bacteriology 20131011 24

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in ...[more]

PMID: 24123815

Similar Datasets

Project description:The SOS response to DNA damage that induces up to 10% of the prokaryotic genome requires RecA action to relieve LexA transcriptional repression. In Acinetobacter species, which lack LexA, the error-prone polymerase accessory UmuDAb is instead required for ddrR induction after DNA damage, suggesting it might be a LexA analog. RNA-Seq experiments defined the DNA damage transcriptome (mitomycin C-induced) of wild type, recA and umuDAb mutant strains of both A. baylyi ADP1 and A. baumannii ATCC 17978. Of the typical SOS response genes, few were differentially regulated in these species; many were repressed or absent. A striking 38.4% of all ADP1 genes, and 11.4% of all 17978 genes, were repressed under these conditions. In A. baylyi ADP1, 66 genes (2.0% of the genome), including a CRISPR/Cas system, were DNA damage-induced, and belonged to four regulons defined by differential use of recA and umuDAb. In A. baumannii ATCC 17978, however, induction of 99% of the 152 mitomycin C-induced genes depended on recA, and only 28 of these genes required umuDAb for their induction. 90% of the induced A. baumannii genes were clustered in three prophage regions, and bacteriophage particles were observed after mitomycin C treatment. These prophages encoded esvI, esvK1, and esvK2, ethanol-stimulated virulence genes previously identified in a Caenorhabditis elegans model, as well as error-prone polymerase alleles. The induction of all 17978 error-prone polymerase alleles, whether prophage-encoded or not, was recA dependent, but only these DNA polymerase V-related genes were de-repressed in the umuDAb mutant in the absence of DNA damage. These results suggest that both species possess a robust and complex DNA damage response involving both recA-dependent and recA-independent regulons, and further demonstrates that although umuDAb has a specialized role in repressing error-prone polymerases, additional regulators likely participate in these species' transcriptional response to DNA damage.

Project description:IntroductionAcinetobacter baumannii strain 17978 is an opportunistic pathogen possessing a DNA damage response (DDR) in which multiple error-prone polymerase genes are co-repressed by a UmuD homolog, UmuDAb, and the small Acinetobacter-specific protein DdrR. Additionally, these regulators coactivate nine other genes. We identified the DNA damage-inducible transcriptome for wildtype, umuDAb, and recA strains, and later established the ddrR DDR transcriptome. However, the ATCC 17978 reference genome had several assembly errors and lacked the 44 kb virulence locus, AbaAL44, that is present in the strain 17978 UN.MethodsFor this project, we combined our earlier single-end read RNAseq data with the ddrR paired-end reads and aligned these data to the improved 17978 UN genome assembly that resembled our laboratory strain, 17978 JH.ResultsNew DESeq2 analyses verified previous differentially expressed genes (DEGs) but also found 339 genes in 17978 JH that were not annotated or physically present in the older genome assembly. Sixty-three were differentially expressed after DNA damage, and 182 had differential basal expression when comparing umuDAb, ddrR, or recA strains to wildtype, with 94 genes' expression unchanged. This work identified and characterized the 55 gene DNA damage-repressible transcriptome, 98% of which required either umuDAb or ddrR for repression. Two-thirds of these DEGs required both regulators. We also identified 110 genes repressed only in the ddrR strain, ~50% of which were due to increased basal expression levels. Basal gene expression in the ddrR mutant was further dysregulated independent of the DDR. Over 800 genes were upregulated, and over 1200 genes were downregulated compared to wildtype expression. Half of A. baumannii's essential genes were upregulated in the ddrR strain, including cell division genes, and two-thirds of these were downregulated in the umuDAb strain.DiscussionThe ddrR mutant upregulated genes enriched in translation, RNA metabolism, protein metabolism, AA/FA/cell-structure synthesis, and transport, while downregulating genes enriched in quorum sensing, biofilm production, secretion systems, pilus production, cell adhesion, and aromatics and chlorine degradation. Our data underscore the need for accurate and appropriately matched genome assemblies and indicate that ddrR affects approximately 60% of the genome, rendering it a potential target for Acinetobacter baumannii infection treatment.

Dataset Information

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

Publications

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets