SYK is a critical regulator of FLT3 in acute myeloid leukemia.
Ontology highlight
ABSTRACT:
SUBMITTER: Puissant A
PROVIDER: S-EPMC4106711 | biostudies-literature | 2014 Feb
REPOSITORIES: biostudies-literature
Publications
SYK is a critical regulator of FLT3 in acute myeloid leukemia.
Puissant Alexandre A Fenouille Nina N Alexe Gabriela G Pikman Yana Y Bassil Christopher F CF Mehta Swapnil S Du Jinyan J Kazi Julhash U JU Luciano Frédéric F Rönnstrand Lars L Kung Andrew L AL Aster Jon C JC Galinsky Ilene I Stone Richard M RM DeAngelo Daniel J DJ Hemann Michael T MT Stegmaier Kimberly K
Cancer cell 20140201 2
Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD p ...[more]
Similar Datasets
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
2014-01-15 | GSE54065 | GEO
Project description:The FMS-like tyrosine kinase 3 (FLT3) pathway has an important role in cellular proliferation, survival, and differentiation. Acute myeloid leukemia (AML) patients with mutated FLT3 have a large disease burden at presentation and a dismal prognosis. A number of FLT3 inhibitors have been developed over the years. The first-generation inhibitors are largely non-specific, while the second-generation inhibitors are more specific and more potent. These inhibitors are used to treat patients with FLT3-mutated AML in virtually all disease settings including induction, consolidation, maintenance, relapse, and after hematopoietic cell transplantation (HCT). In this article, we will review the use of FLT3 inhibitors in AML.
| S-EPMC5789277 | biostudies-literature
Project description:Aberrant FLT3 receptor signaling is common in acute myeloid leukemia (AML) and has important implications for the biology and clinical management of the disease. Patients with FLT3-mutated AML frequently present with critical illness, are more likely to relapse after treatment, and have worse clinical outcomes than their FLT3 wild type counterparts. The clinical management of FLT3-mutated AML has been transformed by the development of FLT3 inhibitors, which are now in use in the frontline and relapsed/refractory settings. However, many questions regarding the optimal approach to the treatment of these patients remain. In this paper, we will review the rationale for targeting the FLT3 receptor in AML, the impact of FLT3 mutation on patient prognosis, the current standard of care approaches to FLT3-mutated AML management, and the diverse array of FLT3 inhibitors in use and under investigation. We will also explore new opportunities and strategies for targeting the FLT3 receptor. These include targeting the receptor in patients with non-canonical FLT3 mutations or wild type FLT3, pairing FLT3 inhibitors with other novel therapies, using minimal residual disease (MRD) testing to guide the targeting of FLT3, and novel immunotherapeutic approaches.
| S-EPMC7927884 | biostudies-literature
Project description:Acute myeloid leukemia (AML) is an aggressive hematologic malignancy which is cured in a minority of patients. A FLT3-internal tandem duplication (ITD) mutation, found in approximately a quarter of patients with de novo AML, imparts a particularly poor prognosis. Patients with FLT3-ITD AML often present with more aggressive disease and have a significantly higher propensity for relapse after remission. The therapeutic approach for these patients has traditionally included intensive induction chemotherapy, followed by consolidative chemotherapy or hematopoietic cell transplantation (HCT). In recent years, multiple small molecule inhibitors of the FLT3 tyrosine kinase have been studied preclinically and in clinical trials. The earlier generation of these agents, often non-specific and impacting a variety of tyrosine kinases, produced at best transient peripheral blood responses in early clinical trials. Additionally, the combination of FLT3 inhibitors with cytotoxic regimens has not, as of yet, demonstrated an improvement in overall survival. Nevertheless, multiple current trials, including those with sorafenib, lestaurtinib, and midostaurin, continue to study the combination of FLT3 inhibitors with standard chemotherapy. Factors such as sustained FLT3 inhibition, protein binding, pharmacokinetics, and the presence of elevated FLT3-ligand levels appear to significantly impact the potency of these agents in vivo. In recent years, the development of more specific and potent agents has generated hope that FLT3 inhibitors may play a more prominent role in the treatment of FLT3-ITD AML in the near future. Nevertheless, questions remain regarding the optimal timing and schedule for incorporation of FLT3 inhibitors. The suitability, type, and timing of allogeneic HCT in the therapeutic approach for these patients are also issues which require further study and definition. Recent retrospective data appears to support the efficacy of allogeneic HCT in first complete remission, possibly due to a graft versus leukemia effect. However, larger prospective studies are necessary to further elucidate the role of HCT and its potential combination with FLT3 inhibitor therapy. We are hopeful that current clinical investigation will lead to an optimization and improvement of outcomes for these patients.
| S-EPMC3301423 | biostudies-literature
Project description:Acute myeloid leukemia (AML) is an aggressive hematopoietic malignancy that is cured in as few as 15%-40% of cases. Tremendous improvements in AML prognostication arose from a comprehensive analysis of leukemia cell genomes. Among normal karyotype AML cases, mutations in the FLT3 gene are the ones most commonly detected as having a deleterious prognostic impact. FLT3 is a transmembrane tyrosine kinase receptor, and alterations of the FLT3 gene such as internal tandem duplications (FLT3-ITD) deregulate FLT3 downstream signaling pathways in favor of increased cell proliferation and survival. FLT3 tyrosine kinase inhibitors (TKI) emerged as a new therapeutic option in FLT3-ITD AML, and clinical trials are ongoing with a variety of TKI either alone, combined with chemotherapy, or even as maintenance after allogenic stem cell transplantation. However, a wide range of molecular resistance mechanisms are activated upon TKI therapy, thus limiting their clinical impact. Massive research efforts are now ongoing to develop more efficient FLT3 TKI and/or new therapies targeting these resistance mechanisms to improve the prognosis of FLT3-ITD AML patients in the future.
| S-EPMC5304990 | biostudies-literature
Project description:Acute myeloid leukemia (AML) is the second most common leukemia of childhood and is associated with high rates of chemotherapy resistance and relapse. Clinical outcomes for children with AML treated with maximally intensive multi-agent chemotherapy lag far behind those of children with the more common acute lymphoblastic leukemia, demonstrating continued need for new therapeutic approaches to decrease relapse risk and improve long-term survival. Mutations in the FMS-like tyrosine kinase-3 receptor gene (FLT3) occur in approximately 25% of children and adults with AML and are associated with particularly poor prognoses. Identification and development of targeted FLT3 inhibitors represents a major precision medicine paradigm shift in the treatment of patients with AML. While further development of many first-generation FLT3 inhibitors was hampered by limited potency and significant toxicity due to effects upon other kinases, the more selective second- and third-generation FLT3 inhibitors have demonstrated excellent tolerability and remarkable efficacy in the relapsed/refractory and now de novo FLT3-mutated AML settings. While these newest and most promising inhibitors have largely been studied in the adult population, pediatric investigation of FLT3 inhibitors with chemotherapy is relatively recently ongoing or planned. Successful development of FLT3 inhibitor-based therapies will be essential to improve outcomes in children with this high-risk subtype of AML.
| S-EPMC5702014 | biostudies-literature
Project description:MiR-126 and miR-155 are key microRNAs (miRNAs) that regulate, respectively, hematopoietic cell quiescence and proliferation. Herein we showed that in acute myeloid leukemia (AML), the biogenesis of these two miRNAs is interconnected through a network of regulatory loops driven by the FMS-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD). In fact, FLT3-ITD induces the expression of miR-155 through a noncanonical mechanism of miRNA biogenesis that implicates cytoplasmic Drosha ribonuclease III (DROSHA). In turn, miR-155 down-regulates SH2-containing inositol phosphatase 1 (SHIP1), thereby increasing phosphor-protein kinase B (AKT) that in turn serine-phosphorylates, stabilizes, and activates Sprouty related EVH1 domain containing 1 (SPRED1). Activated SPRED1 inhibits the RAN/XPO5 complex and blocks the nucleus-to-cytoplasm transport of pre-miR-126, which cannot then complete the last steps of biogenesis. The net result is aberrantly low levels of mature miR-126 that allow quiescent leukemia blasts to be recruited into the cell cycle and proliferate. Thus, miR-126 down-regulation in proliferating AML blasts is downstream of FLT3-ITD–dependent miR-155 expression that initiates a complex circuit of concatenated regulatory feedback (i.e., miR-126/SPRED1, miR-155/human dead-box protein 3 [DDX3X]) and feed-forward (i.e., miR-155/SHIP1/AKT/miR-126) regulatory loops that eventually converge into an output signal for leukemic growth.
| S-EPMC9169767 | biostudies-literature
Project description:Approximately 30% of patients with newly diagnosed acute myeloid leukemia (AML) harbor mutations in the fms-like tyrosine kinase 3 (FLT3) gene. While the adverse prognostic impact of FLT3-ITDmut in AML has been clearly proven, the prognostic significance of FLT3-TKDmut remains speculative. Current guidelines recommend rapid molecular testing for FLT3mut at diagnosis and earlier incorporation of targeted agents to achieve deeper remissions and early consideration for allogeneic stem cell transplant (ASCT). Mounting evidence suggests that FLT3mut can emerge at any timepoint in the disease spectrum emphasizing the need for repetitive mutational testing not only at diagnosis but also at each relapse. The approval of multi-kinase FLT3 inhibitor (FLT3i) midostaurin with induction therapy for newly diagnosed FLT3mut AML, and a more specific, potent FLT3i, gilteritinib as monotherapy for relapsed/refractory (R/R) FLT3mut AML have improved outcomes in patients with FLT3mut AML. Nevertheless, the short duration of remission with single-agent FLT3i's in R/R FLT3mut AML in the absence of ASCT, limited options in patients refractory to gilteritinib therapy, and diverse primary and secondary mechanisms of resistance to different FLT3i's remain ongoing challenges that compel the development and rapid implementation of multi-agent combinatorial or sequential therapies for FLT3mut AML.
| S-EPMC8159924 | biostudies-literature
Project description:Despite significant efforts to improve therapies for acute myeloid leukemia (AML), clinical outcomes remain poor. Understanding the mechanisms that regulate the development and maintenance of leukemic stem cells (LSCs) is important to reveal new therapeutic opportunities. We have identified CD97, a member of the adhesion class of G protein-coupled receptors (GPCRs), as a frequently up-regulated antigen on AML blasts that is a critical regulator of blast function. High levels of CD97 correlate with poor prognosis, and silencing of CD97 reduces disease aggressiveness in vivo. These phenotypes are due to CD97's ability to promote proliferation, survival, and the maintenance of the undifferentiated state in leukemic blasts. Collectively, our data credential CD97 as a promising therapeutic target on LSCs in AML.
| S-EPMC6781010 | biostudies-literature