Injectable, spontaneously assembling, inorganic scaffolds modulate immune cells in vivo and increase vaccine efficacy.
Ontology highlight
ABSTRACT:
SUBMITTER: Kim J
PROVIDER: S-EPMC4318563 | biostudies-literature | 2015 Jan
REPOSITORIES: biostudies-literature
Publications
Injectable, spontaneously assembling, inorganic scaffolds modulate immune cells in vivo and increase vaccine efficacy.
Kim Jaeyun J Li Weiwei Aileen WA Choi Youngjin Y Lewin Sarah A SA Verbeke Catia S CS Dranoff Glenn G Mooney David J DJ
Nature biotechnology 20141208 1
Implanting materials in the body to program host immune cells is a promising alternative to transplantation of cells manipulated ex vivo to direct an immune response, but doing so requires a surgical procedure. Here we demonstrate that high-aspect-ratio, mesoporous silica rods (MSRs) injected with a needle spontaneously assemble in vivo to form macroporous structures that provide a 3D cellular microenvironment for host immune cells. In mice, substantial numbers of dendritic cells are recruited t ...[more]
Similar Datasets
Project description:Injectable polymers have attracted intensive attention in tissue engineering and drug delivery applications. Current injectable polymer systems often require free-radical or heavy-metal initiators and catalysts for the crosslinking process, which may be extremely toxic to the human body. Here, we report a novel polyhedral oligomeric silsesquioxane (POSS) based strain-promoted alkyne-azide cycloaddition (SPAAC) "click" organic-inorganic nanohybrids (click-ON) system that can be click-crosslinked without any toxic initiators or catalysts. The click-ON scaffolds supported excellent adhesion, proliferation, and osteogenesis of stem cells. In vivo evaluation using a rat cranial defect model showed outstanding bone formation with minimum cytotoxicity. Essential osteogenic alkaline phosphatase (ALP) and vascular CD31 marker expression were detected on the defect site, indicating excellent support of in vivo osteogenesis and vascularization. Using salt leaching techniques, an injectable porous click-ON cement was developed to create porous structures and support better in vivo bone regeneration. Beyond defect filling, the click-ON cement also showed promising application for spinal fusion using rabbits as a model. Compared to the current clinically used poly (methyl methacrylate) (PMMA) cement, this click-ON cement showed great advantages of low heat generation, better biocompatibility and biodegradability, and thus has great potential for bone and related tissue engineering applications.
| S-EPMC8916681 | biostudies-literature
Project description:Injectable biomaterials are increasingly being explored to minimize risks and complications associated with surgical implantation. We describe a strategy for delivery via conventional needle-syringe injection of large preformed macroporous scaffolds with well-defined properties. Injectable 3D scaffolds, in the form of elastic sponge-like matrices, were prepared by environmentally friendly cryotropic gelation of a naturally sourced polymer. Cryogels with shape-memory properties may be molded to a variety of shapes and sizes, and may be optionally loaded with therapeutic agents or cells. These scaffolds have the capability to withstand reversible deformations at over 90% strain level, and a rapid volumetric recovery allows the structurally defined scaffolds to be injected through a small-bore needle with nearly complete geometric restoration once delivered. These gels demonstrated long-term release of biomolecules in vivo. Furthermore, cryogels impregnated with bioluminescent reporter cells provided enhanced survival, higher local retention, and extended engraftment of transplanted cells at the injection site compared with a standard injection technique. These injectable scaffolds show great promise for various biomedical applications, including cell therapies.
| S-EPMC3511752 | biostudies-literature
Project description:Injury caused by trauma, burns, surgery, or disease often results in soft tissue loss leading to impaired function and permanent disfiguration. Tissue engineering aims to overcome the lack of viable donor tissue by fabricating synthetic scaffolds with the requisite properties and bioactive cues to regenerate these tissues. Biomaterial scaffolds designed to match soft tissue modulus and strength should also retain the elastomeric and fatigue-resistant properties of the tissue. Of particular design importance is the interconnected porous structure of the scaffold needed to support tissue growth by facilitating mass transport. Adequate mass transport is especially true for newly implanted scaffolds that lack vasculature to provide nutrient flux. Common scaffold fabrication strategies often utilize toxic solvents and high temperatures or pressures to achieve the desired porosity. In this study, a polymerized medium internal phase emulsion (polyMIPE) is used to generate an injectable graft that cures to a porous foam at body temperature without toxic solvents. These poly(ester urethane urea) scaffolds possess elastomeric properties with tunable compressive moduli (20-200 kPa) and strengths (4-60 kPa) as well as high recovery after the first conditioning cycle (97-99%). The resultant pore architecture was highly interconnected with large voids (0.5-2 mm) from carbon dioxide generation surrounded by water-templated pores (50-300 μm). The ability to modulate both scaffold pore architecture and mechanical properties by altering emulsion chemistry was demonstrated. Permeability and form factor were experimentally measured to determine the effects of polyMIPE composition on pore interconnectivity. Finally, initial human mesenchymal stem cell (hMSC) cytocompatibility testing supported the use of these candidate scaffolds in regenerative applications. Overall, these injectable polyMIPE foams show strong promise as a biomaterial scaffold for soft tissue repair.
| S-EPMC3927917 | biostudies-literature
Project description:Integration into a soft material of all the molecular components necessary to generate storable fuels is an interesting target in supramolecular chemistry. The concept is inspired by the internal structure of photosynthetic organelles, such as plant chloroplasts, which colocalize molecules involved in light absorption, charge transport and catalysis to create chemical bonds using light energy. We report here on the light-driven production of hydrogen inside a hydrogel scaffold built by the supramolecular self-assembly of a perylene monoimide amphiphile. The charged ribbons formed can electrostatically attract a nickel-based catalyst, and electrolyte screening promotes gelation. We found the emergent phenomenon that screening by the catalyst or the electrolytes led to two-dimensional crystallization of the chromophore assemblies and enhanced the electronic coupling among the molecules. Photocatalytic production of hydrogen is observed in the three-dimensional environment of the hydrogel scaffold and the material is easily placed on surfaces or in the pores of solid supports.
| S-EPMC4326083 | biostudies-literature
Project description:Mice were immunized with either formalin fixed Influenza A/PR/8/34 (Killed PR8), the 2006-2007 seasonal influenza vaccine, the 2007-2008 seasonal influenza vaccine, a sublethal infection (live PR8) or mock immunized (PBS). Array data was used to distinguish the immunogens from each other and predict which of the three inactivated vaccines would be protective against A/PR/8/34 challenge. two replicates of each peptide was printed on 1 CIM_10kv3 peptide microarray. One microarray were tested for each sample. Image was qualified using in-house metrics for quality assurance.
2013-11-04 | E-GEOD-51623 | biostudies-arrayexpress
Project description:Porous three-dimensional hydrogel scaffolds have an exquisite ability to promote tissue repair. However, because of their high water content and invasive nature during surgical implantation, hydrogels are at an increased risk of bacterial infection. Recently, we have developed elastic biomimetic cryogels, an advanced type of polymeric hydrogel, that are syringe-deliverable through hypodermic needles. These needle-injectable cryogels have unique properties, including large and interconnected pores, mechanical robustness, and shape-memory. Like hydrogels, cryogels are also susceptible to colonization by microbial pathogens. To that end, our minimally invasive cryogels have been engineered to address this challenge. Specifically, we hybridized the cryogels with calcium peroxide microparticles to controllably produce bactericidal hydrogen peroxide. Our novel microcomposite cryogels exhibit antimicrobial properties and inhibit antibiotic-resistant bacteria (MRSA and Pseudomonas aeruginosa), the most common cause of biomaterial implant failure in modern medicine. Moreover, the cryogels showed negligible cytotoxicity toward murine fibroblasts and prevented activation of primary bone marrow-derived dendritic cells ex vivo. Finally, in vivo data suggested tissue integration, biodegradation, and minimal host inflammatory responses when the antimicrobial cryogels, even when purposely contaminated with bacteria, were subcutaneously injected in mice. Collectively, these needle-injectable microcomposite cryogels show great promise for biomedical applications, especially in tissue engineering and regenerative medicine.
| S-EPMC7591905 | biostudies-literature
Project description:The regeneration of functional, clinically viable, tissues from acellular ex vivo tissues has been problematic largely due to poor nutrient transport conditions that limit cell migration and integration. Compounding these issues are subcellular pore sizes that necessarily requires extracellular matrix (ECM) remodeling in order for cells to migrate and regenerate the tissue. The aim of the present work was to create a directed growth environment that allows cells to fully populate an ex vivo-derived vascular scaffold and maintain viability over extended periods. Three different culture conditions using single (one nutrient source) or dual perfusion bioreactor systems (two nutrients sources) were designed to assess the effect of pressure and nutrient gradients under either low (50/30 mmHg) or high (120/80) relative pressure conditions. Human myofibroblasts were seeded to the ablumenal periphery of an ex vivo-derived vascular scaffold using a collagen/hydrogel cell delivery system. After 30 days culture, total cell density was consistent between groups; however, significant variation was noted in cell distribution and construct mechanics as a result of differing perfusion conditions. The most aggressive transport gradient was developed by the single perfusion low-pressure circuits and resulted in a higher proportion of cells migrating across the scaffold toward the vessel lumen (nutrient source). These investigations illustrate the influence of directed nutrient gradients where precisely controlled perfusion conditions significantly affects cell migration, distribution and function, resulting in pronounced effects on construct mechanics during early remodeling events.
| S-EPMC4438987 | biostudies-literature
Project description:Engineered stem cell (SC)-based therapy holds enormous promise for treating the incurable brain cancer glioblastoma (GBM). Retaining the cytotoxic SCs in the surgical cavity after GBM resection is one of the greatest challenges to this approach. Here, we describe a biocompatible electrospun nanofibrous scaffold (bENS) implant capable of delivering and retaining tumor-homing cytotoxic stem cells that suppress recurrence of post-surgical GBM. As a new approach to GBM therapy, we created poly(l-lactic acid) (PLA) bENS bearing drug-releasing human mesenchymal stem cells (hMSCs). We discovered that bENS-based implant increased hMSC retention in the surgical cavity 5-fold and prolonged persistence 3-fold compared to standard direct injection using our mouse model of GBM surgical resection/recurrence. Time-lapse imaging showed cytotoxic hMSC/bENS treatment killed co-cultured human GBM cells, and allowed hMSCs to rapidly migrate off the scaffolds as they homed to GBMs. In vivo, bENS loaded with hMSCs releasing the anti-tumor protein TRAIL (bENS(sTR)) reduced the volume of established GBM xenografts 3-fold. Mimicking clinical GBM patient therapy, lining the post-operative GBM surgical cavity with bENS(sTR) implants inhibited the re-growth of residual GBM foci 2.3-fold and prolonged post-surgical median survival from 13.5 to 31 days in mice. These results suggest that nanofibrous-based SC therapies could be an innovative new approach to improve the outcomes of patients suffering from terminal brain cancer.
| S-EPMC5376347 | biostudies-literature
Project description:DNA demonstrates a remarkable capacity for creating designer nanostructures and devices. A growing number of these structures utilize Förster resonance energy transfer (FRET) as part of the device's functionality, readout or characterization, and, as device sophistication increases so do the concomitant FRET requirements. Here we create multi-dye FRET cascades and assess how well DNA can marshal organic dyes into nanoantennae that focus excitonic energy. We evaluate 36 increasingly complex designs including linear, bifurcated, Holliday junction, 8-arm star and dendrimers involving up to five different dyes engaging in four-consecutive FRET steps, while systematically varying fluorophore spacing by Förster distance (R0). Decreasing R0 while augmenting cross-sectional collection area with multiple donors significantly increases terminal exciton delivery efficiency within dendrimers compared with the first linear constructs. Förster modelling confirms that best results are obtained when there are multiple interacting FRET pathways rather than independent channels by which excitons travel from initial donor(s) to final acceptor.
| S-EPMC4275599 | biostudies-literature
Project description:Purpose: Identical predicted small interfering RNA (siRNA) sequences targeting Apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct compariso of the possible aspecific off-target effects in vivo was performed. Next generation sequencing (NGS) of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5M-bM-^@M-^Y and 3M-bM-^@M-^Y cleavage sites and abundance of the guide or passenger strands. Methods [1]: Total liver RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturerM-bM-^@M-^Ys protocol. Each read file (sample), in the FASTQ format, was individually aligned against the mouse reference genome (15 May 2012 NCBI build 38.1) using CLC Bio-Genomic Workbench and the expression abundance for each gene (RPKM) was calculated according to Montazavi et al. Result [1]s: Based on our previous observations that shApoB and miApoB are differentially processed and that miApoB has a different passenger, we checked for possible aspecific off-target effects in vivo. NGS liver transcriptome analysis was performed 8 weeks p.i. for animals injected with 1x1011 gc AAV encoding shScr, shApoB, miScr and miApoB. We investigated whether shApoB and miApoB processing differences translate into differences in gene expression in injected animals. A total number of 266 genes were significantly changing (p <0,05) in miApoB-injected mice compared to miScr. Additionally 106 genes were found to be significantly up or down-regulated in the shApoB mice compared to shScr. Off-target predictions using Smith-Waterman algorithm for the most abundant guide and passenger strand variants were performed to investigate if any of the observed changes results from aspecific interactions. None of the changing genes had predicted targets for the guide or passenger strands of shApoB or miApoB. Conclusions [1]: An important observation is that none of the changes in gene expression in AAV-miApoB and AAV-shApoB can be explained by possible aspecific down-regulation of non-target transcripts. Methods [2]: For NGS analysis cells were transfected with 4 M-BM-5g shApoB- or miApoB-expression plasmids using Lipofectamine 2000 reagent and total RNA was isolated from cells 48 hr post-transfection using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturerM-bM-^@M-^Ys protocol. Total RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturerM-bM-^@M-^Ys protocol. The NGS small RNA raw data set was analyzed using the CLC_bio genomic workbench (CLC Bio, Aarhus, Denmark). The obtained reads were adaptor-trimmed, which decreased the average read size from ~36bp to ~25bp. The custom adapter sequenced used for trimming all the bases extending 5M-bM-^@M-^Y was: GTGACTGGAGTTCC-TTGGCACCCGAGAATTCCA. All reads containing ambiguity N symbols, reads shorter than 15 nt, longer than 55 nt in length and reads represented less than 10 times were discarded. Next, both data sets from shApoB and miApoB samples were grouped based on the match to the reference sequence and the obtained unique small RNAs were aligned to the sequence of pre-miApoB: GATCCTGGAGGCTTGC-TGAAGGCTGTATGCTGATGGACAGGTCAATCAATCTTGTTTTGGCCACTGACTGACAAGATTGAGACCTGTCCATCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCAG or shApoB: GATCCCCGATTGATTGACCTGTCCATTTCAAGAGAATGGACAGGTCAATCAATC-TTTTTCAGCTT sequence, respectively. To relatively represent the expression counts for the small RNAs obtained in the experiment, reads per million (rpm) or percentage of reads based on the total number of reads matching the reference shApoB or miApoB sequence were calculated Results [2]: The small RNAs were aligned against their reference sequence resulting in 541.939 reads matching shApoB and 1.525.211 reads matching miApoB (Fig S1 and S2). Analysis of the length distribution of the reads indicated that siApoB guide strand originating from shApoB ranged between 19 and 23 nt, with the most abundant one being 21 nt-long. Surprisingly, siApoB guide from miApoB scaffold ranged from 23 to 25 nt with the 24 nt-long strand being the predominant variant. This finding was rather unexpected considering that the predicted guide strand of siApoB was 21 nt long for both shApoB and miApoB scaffolds. Analysis of the processed 5M-bM-^@M-^Y ends of the siApoB guide strand indicated that most of the reads matched position +1 relative to the predicted cleavage site for shApoB, while all the reads matched position 0 for miApoB. The 3M-bM-^@M-^Y ends of the siApoB guide strand had a more heterogeneous pattern and ranged from -1 to +3 for shApoB and +1 to +4 for miApoB. Next, we looked at the sequence distribution and percentage of reads for both the guide and passenger siApoB strands originating from the shApoB and miApoB scaffolds. A substantial difference between the two is that the guide from shApoB is in the 3M-bM-^@M-^Y arm and hence Dicer or other endonuclease defines the cleavage position while the guide is present in the 5M-bM-^@M-^Y arm of miApoB, where Drosha defines the cleavage. Thus, defining the length and exact cleavage position for the guide and passenger strands is very important since even single nucleotide differences may result in significant changes in the predicted targets of the siRNAs. Moreover, the passenger siRNA* strand, if not degraded efficiently, may bind to unanticipated targets and cause off-target effects. As expected, 44.4% of the reads originating from shApoB matched the siApoB guide strand but processing was shifted at position +1 (Fig. 2d, upper panel). Surprisingly only 12.1% of the reads matched perfectly the predicted siApoB guide strand of 21 nt and starting at position 0. The reads matching the passenger siApoB* strand were represented in much lower percentage with the predominant one being only 5.3%. Analysis of the guide strand from the siApoB reads originating from the miApoB scaffold indicated that they all started at the predicted cleavage site. Surprisingly, the predominant, 22.3% of reads were 24 nt-long. Furthermore 5.1% reads were 23 nt- and 1.9% were 25 nt-long. A substantial number of 62% of the reads was found matching the passenger siApoB* strand and ranged between 20 and 22 nt in length. In conclusion, both shApoB and miApoB scaffolds did not yield the predicted siApoB guide or siApoB* passenger sequences after processing from the cellular RNAi machinery. The guide from miApoB was cleaved much more precisely by Drosha at its 5M-bM-^@M-^Y end compared to shApoB that gave more heterogeneous pools of sequences following processing. Conclusions[2]: An unexpected discovery in the current study was that siRNA processing by the cellular RNAi machinery did not follow the generally accepted and described cleavage sites for both molecules shApoB and miApoB siApoB guide strand originating from the shApoB scaffold was more heterogeneous in cleavage sites and length compared to the product originating from the miApoB scaffold. Most likely, differential cleavage mechanism defined the heterogeneity in the guide and passenger strands. Additionally, shRNAs with 19 bp stem or less are not necessarily recognized by Dicer and maybe be processed differently. The heterogeneity seen with the shApoB can also be explained by the potential for 2 or 3 uridines to be added following termination of pol III transcription. The main pool of guide sequences originating from miApoB was 24 nt-long although we used the scaffold of cellular pri-mir-155 that produces a 23 nt mature miRNA. However, a 24 nt-long siApoB sequence did not compromise efficacy because when placed in the miApoB scaffold, the ApoB target sequence was extended at the 3M-bM-^@M-^Y end with 4 nt until the loop. Another important observation is that the siApoB* Liver mRNA profiles of C57BL/6 9 weeks after intravenous AAV injection of 1x1011 gc per animal (~4x1012 gc/kg) of AAV-shRNA, AAV-miRNA or PBS via the tail vein. Next Generation Sequencing on Illumina platform
2012-07-10 | E-GEOD-39187 | biostudies-arrayexpress