Dataset Information

A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture.

ABSTRACT: Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of target site recognition. Cleavage specificity is typically evaluated by low throughput assays (T7 endonuclease I assay, target amplification followed by high-throughput sequencing), which are limited to a subset of potential off-target sites. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites for two guide RNAs. RNA-guided Cas9 binding was highly specific to the target site while off-target binding occurred at much lower intensities. Cas9-bound regions were highly enriched in NGG sites, a sequence required for target site recognition by Streptococcus pyogenes Cas9. To determine the relationship between Cas9 binding and endonuclease activity, we applied targeted sequence capture, which allowed us to survey 1200 genomic loci simultaneously including potential off-target sites identified by ChIP-seq and by computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results confirm the high-specificity of CRISPR endonucleases and demonstrate that sequence capture can be used as a high-throughput genome-wide approach to identify off-target activity.

SUBMITTER: O'Geen H

PROVIDER: S-EPMC4381059 | biostudies-literature | 2015 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture.

O'Geen Henriette H Henry Isabelle M IM Bhakta Mital S MS Meckler Joshua F JF Segal David J DJ

Nucleic acids research 20150220 6

Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of target site recognition. Cleavage specificity is typically evaluated by low throughput assays (T7 endonuclease I assay, target amplification followed by high-throughput sequencing), which are limited to a subset of potential off-target sites. Here, we used ChIP-seq to examine genome-wide C ...[more]

PMID: 25712100

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Project description:ChIP-Seq, which combines chromatin immunoprecipitation (ChIP) with ultra high-throughput massively parallel sequencing, is increasingly being used for mapping protein-DNA interactions in-vivo on a genome scale. Typically, short sequence reads from ChIP-Seq are mapped to a reference genome for further analysis. Although genomic regions enriched with mapped reads could be inferred as approximate binding regions, short read lengths (approximately 25-50 nt) pose challenges for determining the exact binding sites within these regions. Here, we present SISSRs (Site Identification from Short Sequence Reads), a novel algorithm for precise identification of binding sites from short reads generated from ChIP-Seq experiments. The sensitivity and specificity of SISSRs are demonstrated by applying it on ChIP-Seq data for three widely studied and well-characterized human transcription factors: CTCF (CCCTC-binding factor), NRSF (neuron-restrictive silencer factor) and STAT1 (signal transducer and activator of transcription protein 1). We identified 26 814, 5813 and 73 956 binding sites for CTCF, NRSF and STAT1 proteins, respectively, which is 32, 299 and 78% more than that inferred previously for the respective proteins. Motif analysis revealed that an overwhelming majority of the identified binding sites contained the previously established consensus binding sequence for the respective proteins, thus attesting for SISSRs' accuracy. SISSRs' sensitivity and precision facilitated further analyses of ChIP-Seq data revealing interesting insights, which we believe will serve as guidance for designing ChIP-Seq experiments to map in vivo protein-DNA interactions. We also show that tag densities at the binding sites are a good indicator of protein-DNA binding affinity, which could be used to distinguish and characterize strong and weak binding sites. Using tag density as an indicator of DNA-binding affinity, we have identified core residues within the NRSF and CTCF binding sites that are critical for a stronger DNA binding.

Dataset Information

A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture.

Publications

A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets