Dataset Information

Activation of hepatic CREBH and Insig signaling in the anti-hypertriglyceridemic mechanism of R-?-lipoic acid.

ABSTRACT: The activation of sterol regulatory element binding proteins (SREBPs) is regulated by insulin-induced genes 1 and 2 (Insig-1 and Insig-2) and SCAP. We previously reported that feeding R-?-lipoic acid (LA) to Zucker diabetic fatty (ZDF) rats improves severe hypertriglyceridemia. In this study, we investigated the role of cyclic AMP-responsive element binding protein H (CREBH) in the lipid-lowering mechanism of LA and its involvement in the SREBP-1c and Insig pathway. Incubation of McA cells with LA (0.2 mM) or glucose (6 mM) stimulated activation of CREBH. LA treatment further induced mRNA expression of Insig-1 and Insig-2a, but not Insig-2b, in glucose-treated cells. In vivo, feeding LA to obesity-induced hyperlipidemic ZDF rats activated hepatic CREBH and stimulated transcription and translation of Insig-1 and Insig-2a. Activation of CREBH and Insigs induced by LA suppressed processing of SREBP-1c precursor into nuclear SREBP-1c, which subsequently inhibited expression of genes involved in fatty acid synthesis, including FASN, ACC and SCD-1, and reduced triglyceride (TG) contents in both glucose-treated cells and ZDF rat livers. Additionally, LA treatment also decreased abundances of very low density lipoprotein (VLDL)-associated apolipoproteins, apoB100 and apoE, in glucose-treated cells and livers of ZDF rats, leading to decreased secretion of VLDL and improvement of hypertriglyceridemia. This study unveils a novel molecular mechanism whereby LA lowers TG via activation of hepatic CREBH and increased expression of Insig-1 and Insig-2a to inhibit de novo lipogenesis and VLDL secretion. These findings provide novel insight into the therapeutic potential of LA as an anti-hypertriglyceridemia dietary molecule.

SUBMITTER: Tong X

PROVIDER: S-EPMC4547883 | biostudies-literature | 2015 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Activation of hepatic CREBH and Insig signaling in the anti-hypertriglyceridemic mechanism of R-α-lipoic acid.

Tong Xuedong X Christian Patricia P Zhao Miaoyun M Wang Hai H Moreau Regis R Su Qiaozhu Q

The Journal of nutritional biochemistry 20150507 9

The activation of sterol regulatory element binding proteins (SREBPs) is regulated by insulin-induced genes 1 and 2 (Insig-1 and Insig-2) and SCAP. We previously reported that feeding R-α-lipoic acid (LA) to Zucker diabetic fatty (ZDF) rats improves severe hypertriglyceridemia. In this study, we investigated the role of cyclic AMP-responsive element binding protein H (CREBH) in the lipid-lowering mechanism of LA and its involvement in the SREBP-1c and Insig pathway. Incubation of McA cells with ...[more]

PMID: 26007286

Similar Datasets

Project description:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in ?-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by ?-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven ?-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

Project description:The development of single enantiomers with high efficiency and low toxic activity has become a hot spot for the development and application of drugs and active additives. The aim of the present study was to investigate the effectiveness of the application of α-lipoic acid with a different optical rotation to alleviate the inflammation response and oxidative stress induced by oxidized fish oil in laying hens. Sixty-four 124-week-old Peking Red laying hens were randomly allocated to four groups with eight replicates of two birds each. The normal group was fed basal diets supplemented with 1% fresh fish oil (FO), and the oxidative stress model group was constructed with diets supplemented with 1% oxidized fish oil (OFO). The two treatment groups were the S-form of the α-lipoic acid model with 1% oxidized fish oil (OFO + S-LA) and the R-form of the α-lipoic acid model with 1% oxidized fish oil (OFO + R-LA) added at 100 mg/kg, respectively. Herein, these results were evaluated by the breeding performance, immunoglobulin, immune response, estrogen secretion, antioxidant factors of the serum and oviduct, and pathological observation of the uterus part of the oviduct. From the results, diets supplemented with oxidized fish oil can be relatively successful in constructing a model of inflammation and oxidative stress. The OFO group significantly increased the levels of the serum inflammatory factor (TNF-α, IL-1β, IL-6, and IFN-γ) and the oxidative factor MDA and decreased the activity of the antioxidant enzyme (T-AOC, T-SOD, GSH-Px, GSH, and CAT) in the oviduct. The addition of both S-LA and R-LA significantly reduced the levels of serum inflammatory factors (TNF-α, IL-1β, IL-6, and IFN-γ), increased the activity of antioxidant indexes (T-AOC, T-SOD, GSH-Px, GSH, and CAT), and decreased the MDA contents in the serum and oviduct. Meanwhile, the supplementation of S-LA and R-LA also mitigated the negative effects of the OFO on the immunoglobulins (IgA and IgM) and serum hormone levels (P and E2). In addition, it was worth noting that the R-LA was significantly more effective than the S-LA in some inflammatory (IL-1β) and antioxidant indices (T-SOD, GSH, and CAT). Above all, both S-LA and R-LA can alleviate the inflammation and oxidative damage caused by oxidative stress in aged laying hens, and R-LA is more effective than S-LA. Thus, these findings will provide basic data for the potential development of α-lipoic acid as a chiral dietary additive for laying hens.

Dataset Information

Activation of hepatic CREBH and Insig signaling in the anti-hypertriglyceridemic mechanism of R-?-lipoic acid.

Publications

Activation of hepatic CREBH and Insig signaling in the anti-hypertriglyceridemic mechanism of R-α-lipoic acid.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets