Dataset Information

PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

ABSTRACT: The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

SUBMITTER: Cheng M

PROVIDER: S-EPMC4651096 | biostudies-literature | 2015 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

Cheng Minggen M Chen Kai K Guo Suhui S Huang Xing X He Jian J Li Shunpeng S Jiang Jiandong J

Applied and environmental microbiology 20150918 23

The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regu ...[more]

PMID: 26386050

Similar Datasets

Project description:Carboxylesterase PytH, isolated from the pyrethroid-degrading bacterium Sphingobium faniae JZ-2, could rapidly hydrolyze the ester bond of a wide range of pyrethroid pesticides, including permethrin, fenpropathrin, cypermethrin, fenvalerate, deltamethrin, cyhalothrin, and bifenthrin. To elucidate the catalytic mechanism of PytH, we report here the crystal structures of PytH with bifenthrin (BIF) and phenylmethylsulfonyl fluoride (PMSF) and two PytH mutants. Though PytH shares low sequence identity with reported ?/?-hydrolase fold proteins, the typical triad catalytic center with Ser-His-Asp triad (Ser78, His230, and Asp202) is present and vital for the hydrolase activity. However, no contact was found between Ser78 and His230 in the structures we solved, which may be due to the fact that the PytH structures we determined are in their inactive or low-activity forms. The structure of PytH is composed of a core domain and a lid domain; some hydrophobic amino acid residues surrounding the substrate from both domains form a deeper and wider hydrophobic pocket than its homologous structures. This indicates that the larger hydrophobic pocket makes PytH fit for its larger substrate binding; both lid and core domains are involved in substrate binding, and the lid domain-induced core domain movement may make the active center correctly positioned with substrates.IMPORTANCE Pyrethroid pesticides are widely applied in agriculture and household; however, extensive use of these pesticides also causes serious environmental and health problems. The hydrolysis of pyrethroids by carboxylesterases is the major pathway of microbial degradation of pyrethroids, but the structure of carboxylesterases and its catalytic mechanism are still unknown. Carboxylesterase PytH from Sphingobium faniae JZ-2 could effectively hydrolyze a wide range of pyrethroid pesticides. The crystal structures of PytH are solved in this study. This showed that PytH belongs to the ?/?-hydrolase fold proteins with typical catalytic Ser-His-Asp triad, though PytH has a low sequence identity (about 20%) with them. The special large hydrophobic binding pocket enabled PytH to bind bigger pyrethroid family substrates. Our structures shed light on the substrate selectivity and the future application of PytH and deepen our understanding of ?/?-hydrolase members.

Dataset Information

PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

Publications

PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets