Browse
Submit Data
Databases
API
Help

Dataset Information

29 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter.

ABSTRACT: The c-kit oncogene is an important target in the treatment of gastrointestinal tumors. A potential approach to inhibition of the expression of this gene involves selective stabilization of G-quadruplex structures that may be induced to form in the c-kit promoter region. Here we report on the structure of an unprecedented intramolecular G-quadruplex formed by a G-rich sequence in the c-kit promoter in K+ solution. The structure represents a new folding topology with several unique features. Most strikingly, an isolated guanine is involved in G-tetrad core formation, despite the presence of four three-guanine tracts. There are four loops: two single-residue double-chain-reversal loops, a two-residue loop, and a five-residue stem-loop, which contain base-pairing alignments. This unique structural scaffold provides a highly specific platform for the future design of ligands specifically targeted to the promoter DNA of c-kit.

SUBMITTER: Phan AT

PROVIDER: S-EPMC4693632 | biostudies-literature | 2007 Apr

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter.

Phan Anh Tuân AT Kuryavyi Vitaly V Burge Sarah S Neidle Stephen S Patel Dinshaw J DJ

Journal of the American Chemical Society 20070316 14

The c-kit oncogene is an important target in the treatment of gastrointestinal tumors. A potential approach to inhibition of the expression of this gene involves selective stabilization of G-quadruplex structures that may be induced to form in the c-kit promoter region. Here we report on the structure of an unprecedented intramolecular G-quadruplex formed by a G-rich sequence in the c-kit promoter in K+ solution. The structure represents a new folding topology with several unique features. Most ...[more]

PMID: 17362008

Similar Datasets

Extended molecular dynamics of a c-kit promoter quadruplex.

Project description:The 22-mer c-kit promoter sequence folds into a parallel-stranded quadruplex with a unique structure, which has been elucidated by crystallographic and NMR methods and shows a high degree of structural conservation. We have carried out a series of extended (up to 10 ?s long, ?50 ?s in total) molecular dynamics simulations to explore conformational stability and loop dynamics of this quadruplex. Unfolding no-salt simulations are consistent with a multi-pathway model of quadruplex folding and identify the single-nucleotide propeller loops as the most fragile part of the quadruplex. Thus, formation of propeller loops represents a peculiar atomistic aspect of quadruplex folding. Unbiased simulations reveal ?s-scale transitions in the loops, which emphasizes the need for extended simulations in studies of quadruplex loops. We identify ion binding in the loops which may contribute to quadruplex stability. The long lateral-propeller loop is internally very stable but extensively fluctuates as a rigid entity. It creates a size-adaptable cleft between the loop and the stem, which can facilitate ligand binding. The stability gain by forming the internal network of GA base pairs and stacks of this loop may be dictating which of the many possible quadruplex topologies is observed in the ground state by this promoter quadruplex.

| S-EPMC4605300 | biostudies-literature

Sequence occurrence and structural uniqueness of a G-quadruplex in the human c-kit promoter.

Project description:The 22-nt c-kit87 promoter sequence is unique within the human genome. Its fold and tertiary structure have recently been determined by NMR methods [Phan,A.T., Kuryavyi,V., Burge,S., Neidle,S. and Patel,D.J. (2007) Structure of an unprecedented G-quadruplex scaffold in the c-kit promoter. J. Am. Chem. Soc., 129, 4386-4392], and does not have precedent among known DNA quadruplexes. We show here using bioinformatics and molecular dynamics simulations methods that (i) none of the closely related sequences (encompassing all nucleotides not involved in the maintenance of structural integrity) occur immediately upstream (<100 nt) of a transcription start site, and (ii) that all of these sequences correspond to the same stable tertiary structure. It is concluded that the c-kit87 tertiary structure may also be formed in a very small number of other loci in the human genome, but the likelihood of these playing a significant role in the expression of particular genes is very low. The c-kit87 quadruplex thus fulfils a fundamental criterion of a 'good' drug target, in that it possesses distinctive three-dimensional structural features that are only present in at most a handful of other genes.

| S-EPMC2034477 | biostudies-literature

G-Quadruplex Modulation of SP1 Functional Binding Sites at the KIT Proximal Promoter.

Project description:The regulation of conformational arrangements of gene promoters is a physiological mechanism that has been associated with the fine control of gene expression. Indeed, it can drive the time and the location for the selective recruitment of proteins of the transcriptional machinery. Here, we address this issue at the KIT proximal promoter where three G-quadruplex forming sites are present (kit1, kit2 and kit*). On this model, we focused on the interplay between G-quadruplex (G4) formation and SP1 recruitment. By site directed mutagenesis, we prepared a library of plasmids containing mutated sequences of the WT KIT promoter that systematically exploited different G4 formation attitudes and SP1 binding properties. Our transfection data showed that the three different G4 sites of the KIT promoter impact on SP1 binding and protein expression at different levels. Notably, kit2 and kit* structural features represent an on-off system for KIT expression through the recruitment of transcription factors. The use of two G4 binders further helps to address kit2-kit* as a reliable target for pharmacological intervention.

| S-EPMC7795597 | biostudies-literature

Oxidative lesions modulate G-quadruplex stability and structure in the human BCL2 promoter.

Project description:Misregulation of BCL2 expression has been observed with many diseases and is associated with cellular exposure to reactive oxygen species. A region upstream of the P1 promoter in the human BCL2 gene plays a major role in regulating transcription. This G/C-rich region is highly polymorphic and capable of forming G-quadruplex structures. Herein we report that an oxidative event simulated with an 8-oxo-7,8-dihydroguanine (oxoG) substitution within a long G-tract results in a reduction of structural polymorphism. Surprisingly, oxoG within a 25-nt construct boosts thermal stability of the resulting G-quadruplex. This is achieved by distinct hydrogen bonding properties of oxoG, which facilitate formation of an antiparallel basket-type G-quadruplex with a three G-quartet core and a G·oxoG·C base triad. While oxoG has previously been considered detrimental for G-quadruplex formation, its stabilizing effect within a promoter described in this study suggests a potential novel regulatory role of oxidative stress in general and specifically in BCL2 gene transcription.

| S-EPMC7913773 | biostudies-literature

NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region.

Project description:BCL2 protein functions as an inhibitor of cell apoptosis and has been found to be aberrantly expressed in a wide range of human diseases. A highly GC-rich region upstream of the P1 promoter plays an important role in the transcriptional regulation of BCL2. Here we report the NMR solution structure of the major intramolecular G-quadruplex formed on the G-rich strand of this region in K+ solution. This well-defined mixed parallel/antiparallel-stranded G-quadruplex structure contains three G-tetrads of mixed G-arrangements, which are connected with two lateral loops and one side loop, and four grooves of different widths. The three loops interact with the core G-tetrads in a specific way that defines and stabilizes the overall G-quadruplex structure. The loop conformations are in accord with the experimental mutation and footprinting data. The first 3-nt loop adopts a lateral loop conformation and appears to determine the overall folding of the BCL2 G-quadruplex. The third 1-nt double-chain-reversal loop defines another example of a stable parallel-stranded structural motif using the G3NG3 sequence. Significantly, the distinct major BCL2 promoter G-quadruplex structure suggests that it can be specifically involved in gene modulation and can be an attractive target for pathway-specific drug design.

| S-EPMC1636422 | biostudies-literature

Structure of the human telomere in K+ solution: an intramolecular (3 + 1) G-quadruplex scaffold.

Project description:We present the intramolecular G-quadruplex structure of human telomeric DNA in physiologically relevant K(+) solution. This G-quadruplex, whose (3 + 1) topology differs from folds reported previously in Na(+) solution and in a K(+)-containing crystal, involves the following: one anti.syn.syn.syn and two syn.anti.anti.anti G-tetrads; one double-chain reversal and two edgewise loops; three G-tracts oriented in one direction and the fourth in the opposite direction. The topological characteristics of this (3 + 1) G-quadruplex scaffold should provide a unique platform for structure-based anticancer drug design targeted to human telomeric DNA.

| S-EPMC4692383 | biostudies-literature

Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation.

Project description:We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.

| S-EPMC3378867 | biostudies-literature

Triplex-quadruplex structural scaffold: a new binding structure of aptamer.

Project description:Apart from the canonical Watson-Crick duplex, nucleic acids can often form other structures, e.g. G-quadruplex and triplex. These structures give nucleic acid additional functions besides coding for genetic information. Aptamers are one type of functional nucleic acids that bind to specific targets with high selectivity and affinity by folding into special tertiary structures. Despite the fact that numerous aptamers have been reported, only a few different types of aptamer structures are identified. Here we report a novel triplex-quadruplex hybrid scaffold formed by a codeine binding aptamer (CBA). CBA and its derivatives are G-rich DNA sequences. Codeine binding can induce the formation of a complex structure for this aptamer containing a G-quadruplex and a G·GC triplex, while codeine is located at the junction of the triplex and quadruplex. When split CBA into two moieties, codeine does not bind either moieties individually, but can bind them together by inducing the formation of the triplex-quadruplex scaffold. This structure formation induced by codeine binding is shown to inhibit polymerase reaction, which shows a potential application of the aptamer sequence in gene regulations.

| S-EPMC5684193 | biostudies-literature

Solution structure of a unique G-quadruplex scaffold adopted by a guanosine-rich human intronic sequence.

Project description:We report on the solution structure of an unprecedented intramolecular G-quadruplex formed by the guanosine-rich human chl1 intronic d(G(3)-N-G(4)-N(2)-G(4)-N-G(3)-N) 19-mer sequence in K(+)-containing solution. This G-quadruplex, composed of three stacked G-tetrads containing four syn guanines, represents a new folding topology with two unique conformational features. The first guanosine is positioned within the central G-tetrad, in contrast to all previous structures of unimolecular G-quadruplexes, where the first guanosine is part of an outermost G-tetrad. In addition, a V-shaped loop, spanning three G-tetrad planes, contains no bridging nucleotides. The G-quadruplex scaffold is stabilized by a T*G*A triple stacked over the G-tetrad at one end and an unpaired guanosine stacked over the G-tetrad at the other end. Finally, the chl1 intronic DNA G-quadruplex scaffold contains a guanosine base intercalated between an extended G-G step, a feature observed in common with the catalytic site of group I introns. This unique structural scaffold provides a highly specific platform for the future design of ligands specifically targeted to intronic G-quadruplex platforms.

| S-EPMC3381514 | biostudies-literature

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

Project description:In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

| S-EPMC6411839 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data