Dataset Information

Influence of Familial Renal Glycosuria Due to Mutations in the SLC5A2 Gene on Changes in Glucose Tolerance over Time.

ABSTRACT: Familial renal glycosuria is an inherited disorder resulting in glucose excretion in the urine despite normal blood glucose concentrations. It is most commonly due to mutations in the SLC5A2 gene coding for the glucose transporter SGLT2 in the proximal tubule. Several drugs have been introduced as means to lower glucose in patients with type 2 diabetes targeting SGLT2 resulting in renal glycosuria, but no studies have addressed the potential effects of decreased renal glucose reabsorption and chronic glycosuria on the prevention of glucose intolerance. Here we present data on a large pedigree with renal glycosuria due to two mutations (c.300-303+2del and p.A343V) in the SLC5A2 gene. The mutations, which in vitro affected glucose transport in a cell line model, and the ensuing glycosuria were not associated with better glycemic control during a follow-up period of more than 10 years. One individual, who was compound heterozygous for mutations in the SLC5A2 gene suffered from severe urogenital candida infections and postprandial hypoglycemia. In conclusion, in this family with familial glycosuria we did not find any evidence that chronic loss of glucose in the urine would protect from deterioration of the glucose tolerance over time.

SUBMITTER: Ottosson-Laakso E

PROVIDER: S-EPMC4703216 | biostudies-literature | 2016

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Influence of Familial Renal Glycosuria Due to Mutations in the SLC5A2 Gene on Changes in Glucose Tolerance over Time.

Ottosson-Laakso Emilia E Tuomi Tiinamaija T Forsén Björn B Gullström Monika M Groop Per-Henrik PH Groop Leif L Vikman Petter P

PloS one 20160106 1

Familial renal glycosuria is an inherited disorder resulting in glucose excretion in the urine despite normal blood glucose concentrations. It is most commonly due to mutations in the SLC5A2 gene coding for the glucose transporter SGLT2 in the proximal tubule. Several drugs have been introduced as means to lower glucose in patients with type 2 diabetes targeting SGLT2 resulting in renal glycosuria, but no studies have addressed the potential effects of decreased renal glucose reabsorption and ch ...[more]

PMID: 26735923

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Influence of Familial Renal Glycosuria Due to Mutations in the SLC5A2 Gene on Changes in Glucose Tolerance over Time.

Publications

Influence of Familial Renal Glycosuria Due to Mutations in the SLC5A2 Gene on Changes in Glucose Tolerance over Time.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets