Dataset Information

Mutation of KREMEN1, a modulator of Wnt signaling, is responsible for ectodermal dysplasia including oligodontia in Palestinian families.

ABSTRACT: Tooth development is controlled by the same processes that regulate formation of other ectodermal structures. Mutations in the genes underlying these processes may cause ectodermal dysplasia, including severe absence of primary or permanent teeth. Four consanguineous Palestinian families presented with oligodontia and hair and skin features of ectodermal dysplasia. Appearance of ectodermal dysplasia was consistent with autosomal recessive inheritance. Exome sequencing followed by genotyping of 56 informative relatives in the 4 families suggests that the phenotype is due to homozygosity for KREMEN1 p.F209S (c.626?T>C) on chromosome 22 at g.29,521,399 (hg19). The variant occurs in the highly conserved extracellular WSC domain of KREMEN1, which is known to be a high affinity receptor of Dickkopf-1, a component of the Dickkopf-Kremen-LRP6 complex, and a potent regulator of Wnt signaling. The Wnt signaling pathway is critical to development of ectodermal structures. Mutations in WNT10A, LRP6, EDA, and other genes in this pathway lead to tooth agenesis with or without other ectodermal anomalies. Our results implicate KREMEN1 for the first time in a human disorder and provide additional details on the role of the Wnt signaling in ectodermal and dental development.

SUBMITTER: Issa YA

PROVIDER: S-EPMC5027678 | biostudies-literature | 2016 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Mutation of KREMEN1, a modulator of Wnt signaling, is responsible for ectodermal dysplasia including oligodontia in Palestinian families.

Issa Yasmin A YA Kamal Lara L Rayyan Amal Abu AA Dweik Dima D Pierce Sarah S Lee Ming K MK King Mary-Claire MC Walsh Tom T Kanaan Moien M

European journal of human genetics : EJHG 20160406 10

Tooth development is controlled by the same processes that regulate formation of other ectodermal structures. Mutations in the genes underlying these processes may cause ectodermal dysplasia, including severe absence of primary or permanent teeth. Four consanguineous Palestinian families presented with oligodontia and hair and skin features of ectodermal dysplasia. Appearance of ectodermal dysplasia was consistent with autosomal recessive inheritance. Exome sequencing followed by genotyping of 5 ...[more]

PMID: 27049303

Similar Datasets

Project description:IntroductionAn analysis was made of three different syndromes associated with p63 gene mutations, known as ectrodactyly-ectodermal dysplasia-clefting syndrome (EEC), ankyloblepharon-ectodermal dysplasia clefting syndrome (AEC or Hay-Wells) and Rapp-Hodgkin syndrome (RHS). The postoperative complications associated with their cleft reconstructions were also evaluated.Materials and methodsExtensive demographic information, in particular of the clinical appearances, associated malformations, and the types and complications of the reconstructive surgical procedures, were recorded of these syndromic cases occurring in a database of 3621 facial cleft deformity patients. The data was analyzed using the Microsoft Excel program.ResultsA total of 10 (0.28%) cases of p63 associated syndromes were recorded: EEC (6), RHS (3), and AEC (1). The following clinical cleft appearances were noted - EEC = 6: CLA 1 -right side unilateral (female); CLAP 4 - right side (1) + left side (1) unilateral (male + female); bilateral (2) (males); hPsP 1 (female) (divided in 3 Black, 2 White, 1 Indian); RHS = 3: CLAP 2 (White males); hPsP 1 (White female); AEC = 1: CLAP bilateral (White male). Other features of the syndromes were: skin, hand, foot, tooth, hair and nail involvement, and light sensitivity. Postoperative complications included: (i) stenosis of nasal opening, especially after reconstruction of the bilateral cleft lip and the columella lengthening (2 cases), (ii) premaxilla-prolabium fusion (2 cases), (iii) repeated occurrence of oro-nasal fistula in the hard palate (4 cases), and (iv) dysgnathial development of midfacial structures (3 cases).DiscussionThree different p63 associated syndromes (EEC, AEC, and RHS) were diagnosed (0.27% of the total facial cleft deformities database). The majority of the cases presented with a bilateral CLAP in males only. A number of females and males had unilateral CLA. The hPsP-cleft was recorded in females only. The associated ectodermal component most probably had a profoundly negative influence on postoperatively wound healing, which was observed in particular at the nasal openings, the premaxilla sulcus and in the hard palate mucosa. The reconstruction of p63 associated syndromes is a greater challenge than the usual cleft reconstruction to the surgeon.

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Mutation of KREMEN1, a modulator of Wnt signaling, is responsible for ectodermal dysplasia including oligodontia in Palestinian families.

Publications

Mutation of KREMEN1, a modulator of Wnt signaling, is responsible for ectodermal dysplasia including oligodontia in Palestinian families.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets