Absence of hyperlipidemia in LDL receptor-deficient mice having apolipoprotein B100 without the putative receptor-binding sequences.
Ontology highlight
ABSTRACT:
SUBMITTER: Johnson LA
PROVIDER: S-EPMC5268125 | biostudies-literature | 2008 Oct
REPOSITORIES: biostudies-literature
Publications
Absence of hyperlipidemia in LDL receptor-deficient mice having apolipoprotein B100 without the putative receptor-binding sequences.
Johnson Lance A LA Altenburg Michael K MK Walzem Rosemary L RL Scanga Lori T LT Maeda Nobuyo N
Arteriosclerosis, thrombosis, and vascular biology 20080710 10
<h4>Objective</h4>To examine the effects of apoB100 structure, specifically a mutation in the LDLr binding region, on the production of LDL and development of atherosclerosis in vivo.<h4>Methods and results</h4>Ldlr(-/-)Apobec1(-/-) mice lacking the LDLR and apoB editing enzyme accumulated LDL in plasma and developed severe atherosclerosis when they had wild-type apoB100. In marked contrast, in Ldlr(-/-)Apobec1(-/-) mice carrying the Apob100-beta mutation, in the 2 putative LDLR-binding domains ...[more]
Similar Datasets
Project description:BackgroundLack of suitable mouse models has hindered the studying of diabetic macrovascular complications. We examined the effects of type 2 diabetes on coronary artery disease and cardiac function in hypercholesterolemic low-density lipoprotein receptor-deficient apolipoprotein B100-only mice (LDLR-/-ApoB100/100).Methods and results18-month-old LDLR-/-ApoB100/100 (n = 12), diabetic LDLR-/-ApoB100/100 mice overexpressing insulin-like growth factor-II (IGF-II) in pancreatic beta cells (IGF-II/LDLR-/-ApoB100/100, n = 14) and age-matched C57Bl/6 mice (n = 15) were studied after three months of high-fat Western diet. Compared to LDLR-/-ApoB100/100 mice, diabetic IGF-II/LDLR-/-ApoB100/100 mice demonstrated more calcified atherosclerotic lesions in aorta. However, compensatory vascular enlargement was similar in both diabetic and non-diabetic mice with equal atherosclerosis (cross-sectional lesion area ~60%) and consequently the lumen area was preserved. In coronary arteries, both hypercholesterolemic models showed significant stenosis (~80%) despite positive remodeling. Echocardiography revealed severe left ventricular systolic dysfunction and anteroapical akinesia in both LDLR-/-ApoB100/100 and IGF-II/LDLR-/-ApoB100/100 mice. Myocardial scarring was not detected, cardiac reserve after dobutamine challenge was preserved and ultrasructural changes revealed ischemic yet viable myocardium, which together with coronary artery stenosis and slightly impaired myocardial perfusion suggest myocardial hibernation resulting from chronic hypoperfusion.ConclusionsLDLR-/-ApoB100/100 mice develop significant coronary atherosclerosis, severe left ventricular dysfunction with preserved but diminished cardiac reserve and signs of chronic myocardial hibernation. However, the cardiac outcome is not worsened by type 2 diabetes, despite more advanced aortic atherosclerosis in diabetic animals.
| S-EPMC3141395 | biostudies-literature
Project description:GPR40, a G protein-coupled receptor for free fatty acids (FFAs), is considered as a therapeutic target for type 2 diabetes mellitus (T2DM) since GPR40 activation in pancreatic beta cells enhances glucose-stimulated insulin secretion. Nonalcoholic fatty liver disease (NAFLD) is a common complication of T2DM or metabolic syndrome (MetS). However, the role of GPR40 in NAFLD associated with T2DM or MetS has not been well established. Given that it is known that cholesterol and FFAs are critically involved in the pathogenesis of nonalcoholic steatohepatitis (NASH) and LDL receptor (LDLR)-deficient mice are a good animal model for human hyperlipidemia including high cholesterol and FFAs, we generated GPR40 and LDLR double knockout (KO) mice in this study to determine the effect of GPR40 KO on hyperlipidemia-promoted NASH. We showed that GPR40 KO increased plasma levels of cholesterol and FFAs in high-fat diet (HFD)-fed LDLR-deficient mice. We also showed that GPR40 KO exacerbated HFD-induced hepatic steatosis, inflammation and fibrosis. Further study demonstrated that GPR40 KO led to upregulation of hepatic CD36 and genes involved in lipogenesis, fatty acid oxidation, fibrosis and inflammation. Finally, our in vitro mechanistic studies showed that while CD36 was involved in upregulation of proinflammatory molecules in macrophages by palmitic acid (PA) and lipopolysaccharide (LPS), GPR40 activation in macrophages exerts anti-inflammatory effects. Taken together, this study demonstrated for the first time that loss of GPR40 in LDLR-deficient mice exacerbated HFD-induced hyperlipidemia, hepatic steatosis, inflammation and fibrosis potentially through a CD36-dependent mechanism, suggesting that GPR40 may play a beneficial role in hyperlipidemia-associated NASH in LDLR-deficient mice.
| S-EPMC9635748 | biostudies-literature
Project description:Apolipoprotein F (ApoF) modulates lipoprotein metabolism by selectively inhibiting cholesteryl ester transfer protein (CETP) activity on LDL. This ApoF activity requires that it is bound to LDL. How hyperlipidemia alters total plasma ApoF and its binding to LDL are poorly understood. In this study, total ApoF and LDL-bound ApoF were quantified by ELISA. Plasma ApoF is increased 34% in hypercholesterolemic plasma. In hypertriglyceridemic plasma, ApoF was statistically unchanged. However, in donors with combined hypercholesterolemia and hypertriglyceridemia, the elevated triglyceride ameliorated the rise in ApoF caused by hypercholesterolemia alone. Compared to normolipidemic LDL, hypercholesterolemic LDL contained ~2-fold more ApoF per LDL particle, whereas ApoF bound to LDL in hypertriglyceridemia plasma was < 20% of control. To understand the basis for altered association of ApoF with hyperlipidemic LDL, the physiochemical properties of LDL were modified in vitro by CETP ± LCAT activities. The time-dependent change in LDL lipid composition, proteome, core and surface lipid packing, LDL surface charge, and LDL size caused by these factors were compared with the ApoF binding capacity of these LDL. Only LDL particle size correlated with ApoF binding capacity. This positive association between LDL size and ApoF content was confirmed in hyperlipidemic plasmas. Similarly, when in vitro-produced, enlarged LDL with elevated ApoF binding capacity were incubated with LPL to reduce their size, ApoF binding was reduced by 90%. Thus, plasma ApoF levels and the activation status of this ApoF are differentially altered by hypercholesterolemia and hypertriglyceridemia. LDL size is a key determinate of ApoF binding and activation.
2022-02-11 | PXD029713 | Pride
Project description:Purpose: Identical predicted small interfering RNA (siRNA) sequences targeting Apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct compariso of the possible aspecific off-target effects in vivo was performed. Next generation sequencing (NGS) of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5’ and 3’ cleavage sites and abundance of the guide or passenger strands. Methods [1]: Total liver RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturer’s protocol. Each read file (sample), in the FASTQ format, was individually aligned against the mouse reference genome (15 May 2012 NCBI build 38.1) using CLC Bio-Genomic Workbench and the expression abundance for each gene (RPKM) was calculated according to Montazavi et al. Result [1]s: Based on our previous observations that shApoB and miApoB are differentially processed and that miApoB has a different passenger, we checked for possible aspecific off-target effects in vivo. NGS liver transcriptome analysis was performed 8 weeks p.i. for animals injected with 1x1011 gc AAV encoding shScr, shApoB, miScr and miApoB. We investigated whether shApoB and miApoB processing differences translate into differences in gene expression in injected animals. A total number of 266 genes were significantly changing (p <0,05) in miApoB-injected mice compared to miScr. Additionally 106 genes were found to be significantly up or down-regulated in the shApoB mice compared to shScr. Off-target predictions using Smith-Waterman algorithm for the most abundant guide and passenger strand variants were performed to investigate if any of the observed changes results from aspecific interactions. None of the changing genes had predicted targets for the guide or passenger strands of shApoB or miApoB. Conclusions [1]: An important observation is that none of the changes in gene expression in AAV-miApoB and AAV-shApoB can be explained by possible aspecific down-regulation of non-target transcripts. Methods [2]: For NGS analysis cells were transfected with 4 µg shApoB- or miApoB-expression plasmids using Lipofectamine 2000 reagent and total RNA was isolated from cells 48 hr post-transfection using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. Total RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturer’s protocol. The NGS small RNA raw data set was analyzed using the CLC_bio genomic workbench (CLC Bio, Aarhus, Denmark). The obtained reads were adaptor-trimmed, which decreased the average read size from ~36bp to ~25bp. The custom adapter sequenced used for trimming all the bases extending 5’ was: GTGACTGGAGTTCC-TTGGCACCCGAGAATTCCA. All reads containing ambiguity N symbols, reads shorter than 15 nt, longer than 55 nt in length and reads represented less than 10 times were discarded. Next, both data sets from shApoB and miApoB samples were grouped based on the match to the reference sequence and the obtained unique small RNAs were aligned to the sequence of pre-miApoB: GATCCTGGAGGCTTGC-TGAAGGCTGTATGCTGATGGACAGGTCAATCAATCTTGTTTTGGCCACTGACTGACAAGATTGAGACCTGTCCATCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCAG or shApoB: GATCCCCGATTGATTGACCTGTCCATTTCAAGAGAATGGACAGGTCAATCAATC-TTTTTCAGCTT sequence, respectively. To relatively represent the expression counts for the small RNAs obtained in the experiment, reads per million (rpm) or percentage of reads based on the total number of reads matching the reference shApoB or miApoB sequence were calculated Results [2]: The small RNAs were aligned against their reference sequence resulting in 541.939 reads matching shApoB and 1.525.211 reads matching miApoB (Fig S1 and S2). Analysis of the length distribution of the reads indicated that siApoB guide strand originating from shApoB ranged between 19 and 23 nt, with the most abundant one being 21 nt-long. Surprisingly, siApoB guide from miApoB scaffold ranged from 23 to 25 nt with the 24 nt-long strand being the predominant variant. This finding was rather unexpected considering that the predicted guide strand of siApoB was 21 nt long for both shApoB and miApoB scaffolds. Analysis of the processed 5’ ends of the siApoB guide strand indicated that most of the reads matched position +1 relative to the predicted cleavage site for shApoB, while all the reads matched position 0 for miApoB. The 3’ ends of the siApoB guide strand had a more heterogeneous pattern and ranged from -1 to +3 for shApoB and +1 to +4 for miApoB. Next, we looked at the sequence distribution and percentage of reads for both the guide and passenger siApoB strands originating from the shApoB and miApoB scaffolds. A substantial difference between the two is that the guide from shApoB is in the 3’ arm and hence Dicer or other endonuclease defines the cleavage position while the guide is present in the 5’ arm of miApoB, where Drosha defines the cleavage. Thus, defining the length and exact cleavage position for the guide and passenger strands is very important since even single nucleotide differences may result in significant changes in the predicted targets of the siRNAs. Moreover, the passenger siRNA* strand, if not degraded efficiently, may bind to unanticipated targets and cause off-target effects. As expected, 44.4% of the reads originating from shApoB matched the siApoB guide strand but processing was shifted at position +1 (Fig. 2d, upper panel). Surprisingly only 12.1% of the reads matched perfectly the predicted siApoB guide strand of 21 nt and starting at position 0. The reads matching the passenger siApoB* strand were represented in much lower percentage with the predominant one being only 5.3%. Analysis of the guide strand from the siApoB reads originating from the miApoB scaffold indicated that they all started at the predicted cleavage site. Surprisingly, the predominant, 22.3% of reads were 24 nt-long. Furthermore 5.1% reads were 23 nt- and 1.9% were 25 nt-long. A substantial number of 62% of the reads was found matching the passenger siApoB* strand and ranged between 20 and 22 nt in length. In conclusion, both shApoB and miApoB scaffolds did not yield the predicted siApoB guide or siApoB* passenger sequences after processing from the cellular RNAi machinery. The guide from miApoB was cleaved much more precisely by Drosha at its 5’ end compared to shApoB that gave more heterogeneous pools of sequences following processing. Conclusions[2]: An unexpected discovery in the current study was that siRNA processing by the cellular RNAi machinery did not follow the generally accepted and described cleavage sites for both molecules shApoB and miApoB siApoB guide strand originating from the shApoB scaffold was more heterogeneous in cleavage sites and length compared to the product originating from the miApoB scaffold. Most likely, differential cleavage mechanism defined the heterogeneity in the guide and passenger strands. Additionally, shRNAs with 19 bp stem or less are not necessarily recognized by Dicer and maybe be processed differently. The heterogeneity seen with the shApoB can also be explained by the potential for 2 or 3 uridines to be added following termination of pol III transcription. The main pool of guide sequences originating from miApoB was 24 nt-long although we used the scaffold of cellular pri-mir-155 that produces a 23 nt mature miRNA. However, a 24 nt-long siApoB sequence did not compromise efficacy because when placed in the miApoB scaffold, the ApoB target sequence was extended at the 3’ end with 4 nt until the loop. Another important observation is that the siApoB*
2012-07-10 | GSE39187 | GEO
Project description:Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5' and 3' cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 10(11) genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics.
| S-EPMC3538299 | biostudies-literature
Project description:Familial hypercholesterolemia is caused by mutations in the LDL receptor gene (Ldlr). Elevated plasma LDL levels result from slower LDL catabolism and a paradoxical lipoprotein overproduction. We explored the relationship between the presence of the LDL receptor and lipoprotein secretion in hepatocytes from both wild-type and LDL receptor-deficient mice. Ldlr(-/-) hepatocytes secreted apoB100 at a 3.5-fold higher rate than did wild-type hepatocytes. ApoB mRNA abundance, initial apoB synthetic rate, and abundance of the microsomal triglyceride transfer protein 97-kDa subunit did not differ between wild-type and Ldlr(-/-) cells. Pulse-chase analysis and multicompartmental modeling revealed that in wild-type hepatocytes, approximately 55% of newly synthesized apoB100 was degraded. However, in Ldlr(-/-) cells, less than 20% of apoB was degraded. In wild-type hepatocytes, approximately equal amounts of LDL receptor-dependent apoB100 degradation occured via reuptake and presecretory mechanisms. Adenovirus-mediated overexpression of the LDL receptor in Ldlr(-/-) cells resulted in degradation of approximately 90% of newly synthesized apoB100. These studies show that the LDL receptor alters the proportion of apoB that escapes co- or post-translational presecretory degradation and mediates the reuptake of newly secreted apoB-containing lipoprotein particles.
| S-EPMC289165 | biostudies-literature
Project description:Familial combined hyperlipidemia (FCH) is a common lipid disorder characterized by elevations of plasma cholesterol and/or triglyceride in first-degree relatives. A predominance of small, dense LDL particles and elevated apolipoprotein B (apoB) levels is commonly found in members of FCH families. Many studies have investigated the genetic mechanisms determining individuals' lipid levels, in FCH families. Previously, we demonstrated a major gene effect on LDL particle size and codominant Mendelian inheritance involved in determination of apoB levels in a sample of 40 well-defined FCH families. An elevation of apoB levels is associated metabolically with a predominance of small, dense LDL particles in FCH. To establish whether a common gene regulates both traits, we conducted a bivariate genetic analysis to test the hypothesis of a common genetic mechanism. In this study, we found that 66% of the total phenotypic correlation is due to shared genetic components. Further bivariate segregation analysis suggested that both traits share a common major gene plus individual polygenic components. This common major gene explains 37% of the variance of adjusted LDL particle size and 23% of the variance of adjusted apoB levels. Our study suggests that a major gene that has pleiotropic effects on LDL particle size and apoB levels may be the gene underlying FCH in the families we studied.
| S-EPMC1377303 | biostudies-other
Project description:RATIONALE:Genome-wide association studies identified single-nucleotide polymorphisms near the SORT1 locus strongly associated with decreased plasma LDL-C (low-density lipoprotein cholesterol) levels and protection from atherosclerotic cardiovascular disease and myocardial infarction. The minor allele of the causal SORT1 single-nucleotide polymorphism locus creates a putative C/EBP? (CCAAT/enhancer-binding protein ?)-binding site in the SORT1 promoter, thereby increasing in homozygotes sortilin expression by 12-fold in liver, which is rich in this transcription factor. Our previous studies in mice have showed reductions in plasma LDL-C and its principal protein component, apoB (apolipoprotein B) with increased SORT1 expression, and in vitro studies suggested that sortilin promoted the presecretory lysosomal degradation of apoB associated with the LDL precursor, VLDL (very-low-density lipoprotein). OBJECTIVE:To determine directly that SORT1 overexpression results in apoB degradation and to identify the mechanisms by which this reduces apoB and VLDL secretion by the liver, thereby contributing to understanding the clinical phenotype of lower LDL-C levels. METHODS AND RESULTS:Pulse-chase studies directly established that SORT1 overexpression results in apoB degradation. As noted above, previous work implicated a role for lysosomes in this degradation. Through in vitro and in vivo studies, we now demonstrate that the sortilin-mediated route of apoB to lysosomes is unconventional and intersects with autophagy. Increased expression of sortilin diverts more apoB away from secretion, with both proteins trafficking to the endosomal compartment in vesicles that fuse with autophagosomes to form amphisomes. The amphisomes then merge with lysosomes. Furthermore, we show that sortilin itself is a regulator of autophagy and that its activity is scaled to the level of apoB synthesis. CONCLUSIONS:These results strongly suggest that an unconventional lysosomal targeting process dependent on autophagy degrades apoB that was diverted from the secretory pathway by sortilin and provides a mechanism contributing to the reduced LDL-C found in individuals with SORT1 overexpression.
| S-EPMC5815905 | biostudies-literature
Project description:Mipomersen is a 20mer antisense oligonucleotide (ASO) that inhibits apolipoprotein B (apoB) synthesis; its low-density lipoprotein (LDL)-lowering effects should therefore result from reduced secretion of very-low-density lipoprotein (VLDL). We enrolled 17 healthy volunteers who received placebo injections weekly for 3 weeks followed by mipomersen weekly for 7 to 9 weeks. Stable isotopes were used after each treatment to determine fractional catabolic rates and production rates of apoB in VLDL, IDL (intermediate-density lipoprotein), and LDL, and of triglycerides in VLDL. Mipomersen significantly reduced apoB in VLDL, IDL, and LDL, which was associated with increases in fractional catabolic rates of VLDL and LDL apoB and reductions in production rates of IDL and LDL apoB. Unexpectedly, the production rates of VLDL apoB and VLDL triglycerides were unaffected. Small interfering RNA-mediated knockdown of apoB expression in human liver cells demonstrated preservation of apoB secretion across a range of apoB synthesis. Titrated ASO knockdown of apoB mRNA in chow-fed mice preserved both apoB and triglyceride secretion. In contrast, titrated ASO knockdown of apoB mRNA in high-fat-fed mice resulted in stepwise reductions in both apoB and triglyceride secretion. Mipomersen lowered all apoB lipoproteins without reducing the production rate of either VLDL apoB or triglyceride. Our human data are consistent with long-standing models of posttranscriptional and posttranslational regulation of apoB secretion and are supported by in vitro and in vivo experiments. Targeting apoB synthesis may lower levels of apoB lipoproteins without necessarily reducing VLDL secretion, thereby lowering the risk of steatosis associated with this therapeutic strategy.
| S-EPMC4944115 | biostudies-literature
Project description:Apolipoprotein B100 (apoB100) is the main structural protein on Low-density Lipoproteins (LDL) and is the principal ligand for the LDL receptor (LDLR). Because the tertiary structure of apoB100 on LDL has not been determined, the detailed molecular interaction between apoB100 and LDLR is unknown. Here we present the structures of LDL bound to the LDLR and an apoB100 nanobody complex at 4.18Å resolution and a second LDL-LDLR interface at 4.83Å resolution.
2024-12-06 | PXD056510 | Pride