Dataset Information

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

ABSTRACT: Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

SUBMITTER: Li J

PROVIDER: S-EPMC5399899 | biostudies-literature | 2017 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

Li Jie J Zhu Xichun X Ma Lin L Xu Hongwei H Cao Xin X Luo Renyun R Chen Hong H Sun Xiuzhu X Cai Yong Y Lan Xianyong X

Prion 20170301 2

Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associati ...[more]

PMID: 28362554

Similar Datasets

Project description:BackgroundIn a previous study, we demonstrated that some essential proteins from pathogenic organisms contained sizable insertions/deletions (indels) when aligned to human proteins of high sequence similarity. Such indels may provide sufficient spatial differences between the pathogenic protein and human proteins to allow for selective targeting. In one example, an indel difference was targeted via large scale in-silico screening. This resulted in selective antibodies and small compounds which were capable of binding to the deletion-bearing essential pathogen protein without any cross-reactivity to the highly similar human protein. The objective of the current study was to investigate whether indels were found more frequently in essential than non-essential proteins.ResultsWe have investigated three species, Bacillus subtilis, Escherichia coli, and Saccharomyces cerevisiae, for which high-quality protein essentiality data is available. Using these data, we demonstrated with t-test calculations that the mean indel frequencies in essential proteins were greater than that of non-essential proteins in the three proteomes. The abundance of indels in both types of proteins was also shown to be accurately modeled by the Weibull distribution. However, Receiver Operator Characteristic (ROC) curves showed that indel frequencies alone could not be used as a marker to accurately discriminate between essential and non-essential proteins in the three proteomes. Finally, we analyzed the protein interaction data available for S. cerevisiae and observed that indel-bearing proteins were involved in more interactions and had greater betweenness values within Protein Interaction Networks (PINs).ConclusionOverall, our findings demonstrated that indels were not randomly distributed across the studied proteomes and were likely to occur more often in essential proteins and those that were highly connected, indicating a possible role of sequence insertions and deletions in the regulation and modification of protein-protein interactions. Such observations will provide new insights into indel-based drug design using bioinformatics and cheminformatics tools.

Project description:We developed 21,499 genome-wide insertion-deletion (InDel) markers (2- to 54-bp in silico fragment length polymorphism) by comparing the genomic sequences of four (desi, kabuli and wild C. reticulatum) chickpea [Cicer arietinum (L.)] accessions. InDel markers showing 2- to 6-bp fragment length polymorphism among accessions were abundant (76.8%) in the chickpea genome. The physically mapped 7,643 and 13,856 markers on eight chromosomes and unanchored scaffolds, respectively, were structurally and functionally annotated. The 4,506 coding (23% large-effect frameshift mutations) and regulatory InDel markers were identified from 3,228 genes (representing 11.7% of total 27,571 desi genes), suggesting their functional relevance for trait association/genetic mapping. High amplification (97%) and intra-specific polymorphic (60-83%) potential and wider genetic diversity (15-89%) were detected by genome-wide 6,254 InDel markers among desi, kabuli and wild accessions using even a simpler cost-effective agarose gel-based assay. This signifies added advantages of this user-friendly genetic marker system for manifold large-scale genotyping applications in laboratories with limited infrastructure and resources. Utilizing 6,254 InDel markers-based high-density (inter-marker distance: 0.212 cM) inter-specific genetic linkage map (ICC 4958 × ICC 17160) of chickpea as a reference, three major genomic regions harboring six flowering and maturity time robust QTLs (16.4-27.5% phenotypic variation explained, 8.1-11.5 logarithm of odds) were identified. Integration of genetic and physical maps at these target QTL intervals mapped on three chromosomes delineated five InDel markers-containing candidate genes tightly linked to the QTLs governing flowering and maturity time in chickpea. Taken together, our study demonstrated the practical utility of developing and high-throughput genotyping of such beneficial InDel markers at a genome-wide scale to expedite genomics-assisted breeding applications in chickpea.

Project description:BACKGROUND: For decades, linkage mapping has been one of the most powerful and widely used approaches for elucidating the genetic architecture of phenotypic traits of medical, agricultural and evolutionary importance. However, successful mapping of Mendelian and quantitative phenotypic traits depends critically on the availability of fast and preferably high-throughput genotyping platforms. Several array-based single nucleotide polymorphism (SNP) genotyping platforms have been developed for genetic model organisms during recent years but most of these methods become prohibitively expensive for screening large numbers of individuals. Therefore, inexpensive, simple and flexible genotyping solutions that enable rapid screening of intermediate numbers of loci (approximately 75-300) in hundreds to thousands of individuals are still needed for QTL mapping applications in a broad range of organisms. RESULTS: Here we describe the discovery of and application of insertion-deletion (INDEL) polymorphisms for cost-efficient medium throughput genotyping that enables analysis of >75 loci in a single automated sequencer electrophoresis column with standard laboratory equipment. Genotyping of INDELs requires low start-up costs, includes few standard sample handling steps and is applicable to a broad range of species for which expressed sequence tag (EST) collections are available. As a proof of principle, we generated a partial INDEL linkage map in Atlantic salmon (Salmo salar) and rapidly identified a number of quantitative trait loci (QTLs) affecting early life-history traits that are expected to have important fitness consequences in the natural environment. CONCLUSIONS: The INDEL genotyping enabled fast coarse-mapping of chromosomal regions containing QTL, thus providing an efficient means for characterization of genetic architecture in multiple crosses and large pedigrees. This enables not only the discovery of larger number of QTLs with relatively smaller phenotypic effect but also provides a cost-effective means for evaluation of the frequency of segregating QTLs in outbred populations which is important for further understanding how genetic variation underlying phenotypic traits is maintained in the wild.

Dataset Information

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

Publications

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets