Browse
Submit Data
Databases
API
Help

Dataset Information

26 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Pathogenic Variant in ACTB, p.Arg183Trp, Causes Juvenile-Onset Dystonia, Hearing Loss, and Developmental Delay without Midline Malformation.

ABSTRACT: ACTB encodes the ?-actin, and pathogenic variations in this gene have typically been associated with Baraitser-Winter cerebrofrontofacial syndrome, a congenital malformation syndrome characterized by short stature, craniofacial anomalies, and cerebral anomalies. Here, we describe the third case with the p.Arg183Trp variant in ACTB causing juvenile-onset dystonia. Our patient has severe, intractable dystonia, developmental delay, and sensorineural hearing loss, besides hyperintensities in the caudate nuclei and putamen on the brain MRI, which is a distinct but overlapping phenotype with the previously reported case of identical twins with the same alteration in ACTB.

SUBMITTER: Conboy E

PROVIDER: S-EPMC5405358 | biostudies-literature | 2017

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Pathogenic Variant in ACTB, p.Arg183Trp, Causes Juvenile-Onset Dystonia, Hearing Loss, and Developmental Delay without Midline Malformation.

Conboy Erin E Vairo Filippo F Waggoner Darrel D Ober Carole C Das Soma S Dhamija Radhika R Klee Eric W EW Pichurin Pavel P

Case reports in genetics 20170412

ACTB encodes the β-actin, and pathogenic variations in this gene have typically been associated with Baraitser-Winter cerebrofrontofacial syndrome, a congenital malformation syndrome characterized by short stature, craniofacial anomalies, and cerebral anomalies. Here, we describe the third case with the p.Arg183Trp variant in ACTB causing juvenile-onset dystonia. Our patient has severe, intractable dystonia, developmental delay, and sensorineural hearing loss, besides hyperi ...[more]

PMID: 28487785

Similar Datasets

IMPDH2: a new gene associated with dominant juvenile-onset dystonia-tremor disorder.

Project description:The aetiology of dystonia disorders is complex, and next-generation sequencing has become a useful tool in elucidating the variable genetic background of these diseases. Here we report a deleterious heterozygous truncating variant in the inosine monophosphate dehydrogenase gene (IMPDH2) by whole-exome sequencing, co-segregating with a dominantly inherited dystonia-tremor disease in a large Finnish family. We show that the defect results in degradation of the gene product, causing IMPDH2 deficiency in patient cells. IMPDH2 is the first and rate-limiting enzyme in the de novo biosynthesis of guanine nucleotides, a dopamine synthetic pathway previously linked to childhood or adolescence-onset dystonia disorders. We report IMPDH2 as a new gene to the dystonia disease entity. The evidence underlines the important link between guanine metabolism, dopamine biosynthesis and dystonia.

| S-EPMC8633184 | biostudies-literature

A Novel 3q29 Deletion in Association With Developmental Delay and Heart Malformation-Case Report With Literature Review.

Project description:3q29 deletion syndrome is a rare disorder, causing a complex phenotype. Clinical features are variable and relatively non-specific. Our report aims to present an atypical, de novo deletion in chromosome band 3q29 in a preschool boy, first child of healthy non-consanguineous parents, presenting a particular phenotype (microcephaly, "full moon" face, flattened facial profile, large ears, auricular polyp, and dental dystrophies), motor and cognitive delay, characteristics of autism spectrum disorder and aggressive behavior. He also presented intrauterine growth restriction (birth weight 2,400 g) and a ventricular septal defect. SNP Array revealed a 962 kb copy number loss, on the chromosome 3q29 band (195519857-196482211), consistent with 3q29 microdeletion syndrome. FISH analysis using a RP11-252K11 probe confirmed the deletion in the proband, which was not present in the parents. Although the patient's deletion is relatively small, it partly overlaps the canonical 3q29 deletion (defined between TFRC and DLG1 gene) and extends upstream, associating a different facial phenotype compared to the classic 3q29 deletion, nonetheless showing a similar psychiatric disorder. This deletion is different from the canonical region, as it does not include the PAK2 and DLG1 genes, considered as candidates for causing intellectual disability. Thus, narrowing the genotype-phenotype correlation for the 3q29 band, FBX045 is suggested as a candidate gene for the neuropsychiatric phenotype.

| S-EPMC6628938 | biostudies-literature

Genetic risk for schizophrenia and developmental delay is associated with shape and microstructure of midline white-matter structures.

Project description:Genomic copy number variants (CNVs) are amongst the most highly penetrant genetic risk factors for neuropsychiatric disorders. The scarcity of carriers of individual CNVs and their phenotypical heterogeneity limits investigations of the associated neural mechanisms and endophenotypes. We applied a novel design based on CNV penetrance for schizophrenia (Sz) and developmental delay (DD) that allows us to identify structural sequelae that are most relevant to neuropsychiatric disorders. Our focus on brain structural abnormalities was based on the hypothesis that convergent mechanisms contributing to neurodevelopmental disorders would likely manifest in the macro- and microstructure of white matter and cortical and subcortical grey matter. Twenty one adult participants carrying neuropsychiatric risk CNVs (including those located at 22q11.2, 15q11.2, 1q21.1, 16p11.2 and 17q12) and 15 age- and gender-matched controls underwent T1-weighted structural, diffusion and relaxometry MRI. The macro- and microstructural properties of the cingulum bundles were associated with penetrance for both developmental delay and schizophrenia, in particular curvature along the anterior-posterior axis (Sz: pcorr = 0.026; DD: pcorr = 0.035) and intracellular volume fraction (Sz: pcorr = 0.019; DD: pcorr = 0.064). Further principal component analysis showed alterations in the interrelationships between the volumes of several midline white-matter structures (Sz: pcorr = 0.055; DD: pcorr = 0.027). In particular, the ratio of volumes in the splenium and body of the corpus callosum was significantly associated with both penetrance scores (Sz: p = 0.037; DD; p = 0.006). Our results are consistent with the notion that a significant alteration in developmental trajectories of midline white-matter structures constitutes a common neurodevelopmental aberration contributing to risk for schizophrenia and intellectual disability.

| S-EPMC6389944 | biostudies-literature

ATP1A3 mutations in infants: a new rapid-onset dystonia-Parkinsonism phenotype characterized by motor delay and ataxia.

Project description:We report new clinical features of delayed motor development, hypotonia, and ataxia in two young children with mutations (R756H and D923N) in the ATP1A3 gene. In adults, mutations in ATP1A3 cause rapid-onset dystonia-Parkinsonism (RDP, DYT12) with abrupt onset of fixed dystonia. The parents and children were examined and videotaped, and samples were collected for mutation analysis. Case 1 presented with fluctuating spells of hypotonia, dysphagia, mutism, dystonia, and ataxia at 9 months. After three episodes of hypotonia, she developed ataxia, inability to speak or swallow, and eventual seizures. Case 2 presented with hypotonia at 14 months and pre-existing motor delay. At age 4 years, he had episodic slurred speech, followed by ataxia, drooling, and dysarthria. He remains mute. Both children had ATP1A3 gene mutations. To our knowledge, these are the earliest presentations of RDP, both with fluctuating features. Both children were initially misdiagnosed. RDP should be considered in children with discoordinated gait, and speech and swallowing difficulties.

| S-EPMC3465467 | biostudies-literature

Project description:Analysis of chromosomal rearrangements has been highly successful in identifying genes involved in many congenital abnormalities including hearing loss. Herein, we report a subject, designated DGAP242, with congenital hearing loss (HL) and a de novo balanced translocation 46,XX,t(1;5)(q32;q15)dn. Using multiple next-generation sequencing techniques, we obtained high resolution of the breakpoints. This revealed disruption of the orphan receptor ESRRG on chromosome 1, which is differentially expressed in inner ear hair cells and has previously been implicated in HL, and disruption of KIAA0825 on chromosome 5. Given the translocation breakpoints and supporting literature, disruption of ESRRG is the most likely cause for DGAP242's phenotype and implicates ESRRG in a monogenic form of congenital HL, although a putative contributory role for KIAA0825 in the subject's disorder cannot be excluded.

| S-EPMC5110062 | biostudies-literature

NAA80 bi-allelic missense variants result in high-frequency hearing loss, muscle weakness and developmental delay.

Project description:The recent identification of NAA80/NAT6 as the enzyme that acetylates actins generated new insight into the process of post-translational actin modifications; however, the role of NAA80 in human physiology and pathology has not been clarified yet. We report two individuals from a single family harbouring a homozygous c.389T>C, p.(Leu130Pro) NAA80 genetic variant. Both individuals show progressive high-frequency sensorineural hearing loss, craniofacial dysmorphisms, developmental delay and mild proximal and axial muscle weakness. Based on the molecular structure, we predicted and confirmed the NAA80 c.389T>C, p.(Leu130Pro) variant to result in protein destabilization, causing severely decreased NAA80 protein availability. Concurrently, individuals exhibited a ∼50% decrease of actin acetylation. NAA80 individual derived fibroblasts and peripheral blood mononuclear cells showed increased migration, increased filopodia counts and increased levels of polymerized actin, in agreement with previous observations in NAA80 knock-out cells. Furthermore, the significant clinical overlap between NAA80 individuals and individuals with pathogenic variants in several actin subtypes reflects the general importance of controlled actin dynamics for the inner ear, brain and muscle. Taken together, we describe a new syndrome, caused by NAA80 genetic variants leading to decreased actin acetylation and disrupted associated molecular functions. Our work suggests a crucial role for NAA80-mediated actin dynamics in neuronal health, muscle health and hearing.

| S-EPMC8599064 | biostudies-literature

Pathogenic convergence of CNVs in genes functionally associated to a severe neuromotor developmental delay syndrome.

Project description:BackgroundComplex developmental encephalopathy syndromes might be the consequence of unknown genetic alterations that are likely to contribute to the full neurological phenotype as a consequence of pathogenic gene combinations.MethodsTo identify the additional genetic contribution to the neurological phenotype, we studied as a test case a boy, with a KCNQ2 exon-7 partial duplication, by single-nucleotide polymorphism (SNP) microarray to detect copy-number variations (CNVs).ResultsThe proband presented a cerebral palsy like syndrome with a severe motor and developmental encephalopathy. The SNP array analysis detected in the proband several de novo CNVs, nine partial gene losses (LRRC55, PCDH9, NALCN, RYR3, ELAVL2, CDH13, ATP1A2, SLC17A5, ANO3), and two partial gene duplications (PCDH19, EFNA5). The biological functions of these genes are associated with ion channels such as calcium, chloride, sodium, and potassium with several membrane proteins implicated in neural cell-cell interactions, synaptic transmission, and axon guidance. Pathogenically, these functions can be associated to cerebral palsy, seizures, dystonia, epileptic crisis, and motor neuron dysfunction, all present in the patient.ConclusionsSevere motor and developmental encephalopathy syndromes of unknown origin can be the result of a phenotypic convergence by combination of several genetic alterations in genes whose physiological function contributes to the neurological pathogenic mechanism.

| S-EPMC7871650 | biostudies-literature

ACTB Loss-of-Function Mutations Result in a Pleiotropic Developmental Disorder.

Project description:ACTB encodes β-actin, an abundant cytoskeletal housekeeping protein. In humans, postulated gain-of-function missense mutations cause Baraitser-Winter syndrome (BRWS), characterized by intellectual disability, cortical malformations, coloboma, sensorineural deafness, and typical facial features. To date, the consequences of loss-of-function ACTB mutations have not been proven conclusively. We describe heterozygous ACTB deletions and nonsense and frameshift mutations in 33 individuals with developmental delay, apparent intellectual disability, increased frequency of internal organ malformations (including those of the heart and the renal tract), growth retardation, and a recognizable facial gestalt (interrupted wavy eyebrows, dense eyelashes, wide nose, wide mouth, and a prominent chin) that is distinct from characteristics of individuals with BRWS. Strikingly, this spectrum overlaps with that of several chromatin-remodeling developmental disorders. In wild-type mouse embryos, β-actin expression was prominent in the kidney, heart, and brain. ACTB mRNA expression levels in lymphoblastic lines and fibroblasts derived from affected individuals were decreased in comparison to those in control cells. Fibroblasts derived from an affected individual and ACTB siRNA knockdown in wild-type fibroblasts showed altered cell shape and migration, consistent with known roles of cytoplasmic β-actin. We also demonstrate that ACTB haploinsufficiency leads to reduced cell proliferation, altered expression of cell-cycle genes, and decreased amounts of nuclear, but not cytoplasmic, β-actin. In conclusion, we show that heterozygous loss-of-function ACTB mutations cause a distinct pleiotropic malformation syndrome with intellectual disability. Our biological studies suggest that a critically reduced amount of this protein alters cell shape, migration, proliferation, and gene expression to the detriment of brain, heart, and kidney development.

| S-EPMC5812896 | biostudies-literature

A novel de novo CAPN5 mutation in a patient with inflammatory vitreoretinopathy, hearing loss, and developmental delay.

Project description:Mutations that activate the protease calpain-5 (CAPN5) cause a nonsyndromic adult-onset autoinflammatory eye disease characterized by uveitis, altered synaptic signaling, retinal degeneration, neovascularization, and intraocular fibrosis. We describe a pediatric patient with severe inflammatory vitreoretinopathy accompanied by hearing loss and developmental delay associated with a novel, de novo CAPN5 missense mutation (c.865C>T, p.Arg289Trp) that shows greater hyperactivation of the calpain protease, indicating a genotype-phenotype correlation that links mutation severity to proteolytic activity and the possibility of earlier onset syndromic disease with auditory and neurological abnormalities.

| S-EPMC5983175 | biostudies-literature

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

Project description:Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

| S-EPMC7308501 | biostudies-literature