Dataset Information

Novel mutations including deletions of the entire OFD1 gene in 30 families with type 1 orofaciodigital syndrome: a study of the extensive clinical variability.

ABSTRACT: OFD1, now recognized as a ciliopathy, is characterized by malformations of the face, oral cavity and digits, and is transmitted as an X-linked condition with lethality in males. Mutations in OFD1 also cause X-linked Joubert syndrome (JBTS10) and Simpson-Golabi-Behmel syndrome type 2 (SGBS2). We have studied 55 sporadic and six familial cases of suspected OFD1. Comprehensive mutation analysis in OFD1 revealed mutations in 37 female patients from 30 families; 22 mutations have not been previously described including two heterozygous deletions spanning OFD1 and neighbouring genes. Analysis of clinical findings in patients with mutations revealed that oral features are the most reliable diagnostic criteria. A first, detailed evaluation of brain MRIs from seven patients with cognitive defects illustrated extensive variability with the complete brain phenotype consisting of complete agenesis of the corpus callosum, large single or multiple interhemispheric cysts, striking cortical infolding of gyri, ventriculomegaly, mild molar tooth malformation and moderate to severe cerebellar vermis hypoplasia. Although the OFD1 gene apparently escapes X-inactivation, skewed inactivation was observed in seven of 14 patients. The direction of skewing did not correlate with disease severity, reinforcing the hypothesis that additional factors contribute to the extensive intrafamilial variability.

SUBMITTER: Bisschoff IJ

PROVIDER: S-EPMC5497464 | biostudies-literature | 2013 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Novel mutations including deletions of the entire OFD1 gene in 30 families with type 1 orofaciodigital syndrome: a study of the extensive clinical variability.

Bisschoff Izak J IJ Zeschnigk Christine C Horn Denise D Wellek Brigitte B Rieß Angelika A Wessels Maja M Willems Patrick P Jensen Peter P Busche Andreas A Bekkebraten Jens J Chopra Maya M Hove Hanne Dahlgaard HD Evers Christina C Heimdal Ketil K Kaiser Ann-Sophie AS Kunstmann Erdmut E Robinson Kristina Lagerstedt KL Linné Maja M Martin Patricia P McGrath James J Pradel Winnie W Prescott Katrina E KE Roesler Bernd B Rudolf Gorazd G Siebers-Renelt Ulrike U Tyshchenko Nataliya N Wieczorek Dagmar D Wolff Gerhard G Dobyns William B WB Morris-Rosendahl Deborah J DJ

Human mutation 20121017 1

OFD1, now recognized as a ciliopathy, is characterized by malformations of the face, oral cavity and digits, and is transmitted as an X-linked condition with lethality in males. Mutations in OFD1 also cause X-linked Joubert syndrome (JBTS10) and Simpson-Golabi-Behmel syndrome type 2 (SGBS2). We have studied 55 sporadic and six familial cases of suspected OFD1. Comprehensive mutation analysis in OFD1 revealed mutations in 37 female patients from 30 families; 22 mutations have not been previously ...[more]

PMID: 23033313

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Novel mutations including deletions of the entire OFD1 gene in 30 families with type 1 orofaciodigital syndrome: a study of the extensive clinical variability.

Publications

Novel mutations including deletions of the entire OFD1 gene in 30 families with type 1 orofaciodigital syndrome: a study of the extensive clinical variability.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets