Dataset Information

Polymorphisms in the Estrogen Receptor Beta Gene and the Risk of Unexplained Recurrent Spontaneous Abortion.

ABSTRACT: BACKGROUND:Recurrent Spontaneous Abortion (RSA) is caused by multiple genetic and non-genetic factors. Around 50% of the RSA cases have no known etiology and are considered as Unexplained RSA (URSA). Estrogens, via binding to their receptors, play an important role in female reproduction. This study aimed to investigate whether single nucleotide polymorphisms (SNPs; +1082G/A, +1730G/A and rs1256030 C/T) in the estrogen receptor beta (ESR2) gene are associated with susceptibility to URSA in a population of Iranian women. METHODS:In this case-control study, the study groups consisted of 240 subjects with a history of URSA and 102 fertile women as controls. Serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), and estradiol (E2) were measured on day 2-3 of menstrual cycle. Two functional SNPs, +1082G/A (a silent mutation in exon 5) and +1730G/A (3' untranslated region of the exon 8), and one intron, rs1256030C/T, in the ESR2 gene were genotyped, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. RESULTS:Serum levels of LH were significantly increased in URSA women. No significant differences in distribution of +1082G/A, +1730G/A and rs1256030C/T between URSA and control groups were observed. CONCLUSION:Our findings suggest that the studied SNPs on ESR2 gene may not be associated with URSA.

SUBMITTER: Mahdavipour M

PROVIDER: S-EPMC5501144 | biostudies-literature | 2017 Jul-Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Polymorphisms in the Estrogen Receptor Beta Gene and the Risk of Unexplained Recurrent Spontaneous Abortion.

Mahdavipour Marzieh M Zarei Saeed S Fatemi Ramina R Edalatkhah Haleh H Heidari-Vala Hamed H Jeddi-Tehrani Mahmood M Idali Farah F

Avicenna journal of medical biotechnology 20170701 3

<h4>Background</h4>Recurrent Spontaneous Abortion (RSA) is caused by multiple genetic and non-genetic factors. Around 50% of the RSA cases have no known etiology and are considered as Unexplained RSA (URSA). Estrogens, <i>via</i> binding to their receptors, play an important role in female reproduction. This study aimed to investigate whether single nucleotide polymorphisms (SNPs; +1082G/A, +1730G/A and rs1256030 C/T) in the estrogen receptor beta (<i>ESR2</i>) gene are associated with susceptib ...[more]

PMID: 28706612

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundRecurrent spontaneous abortion (RSA) refers to 2 or more consecutive pregnancy losses, and RSA with unknown causes is called unexplained recurrent spontaneous abortion (URSA). Tim-3, a subtype of the T-cell immunoglobulin domain and mucin domain (Tim) protein family, might be an important regulatory molecule that plays a pivotal role in URSA, which might be triggered mostly by Th1/Th2 immune deviation. To understand the etiology and pathogenesis of URSA in Han Chinese women, we investigated the association between polymorphisms of rs10053538 and rs10515746 in the promoter of Tim-3 and the risk of URSA in Han Chinese women.MethodsOne hundred and forty-eight women with RSA resulting in still birth were enrolled in the URSA group. We performed tests to rule out congenital reproductive system malformation, reproductive system tumor, endocrine dyscrasia, and chromosome abnormalities. One hundred and fifty-three women with normal pregnancy leading to live birth were selected at random to comprise the control group. All women included in this study were genetically unrelated Han Chinese women. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele-specific polymerase chain reaction (AS-PCR) were used to determine polymorphisms of rs10053538 and rs10515746, respectively, in all subjects. PCR products were chosen at random for sequencing.ResultsNo significant statistical difference was found between the distribution frequency of the GT + TT genotype and T allele on the rs10053538 locus in the URSA group or the control group (10.1% vs. 11.8%, Chi(2) = 0.205, P = 0.651; 5.1% vs. 6.5%, Chi(2) = 0.592, P = 0.441; respectively). Neither was there a significant difference between the distribution frequency of the GT + TT genotype and T allele on the rs10515746 locus in the groups (6.8% vs. 3.9%, Chi(2)1.201, P = 0.273; 3.4% vs. 2.0%, Chi(2) = 1.169, P = 0.280; respectively).ConclusionsThe present study suggested that these polymorphisms of rs10053538 or rs10515746 in the Tim-3 promoter may not be associated with URSA in Han Chinese women.

Dataset Information

Polymorphisms in the Estrogen Receptor Beta Gene and the Risk of Unexplained Recurrent Spontaneous Abortion.

Publications

Polymorphisms in the Estrogen Receptor Beta Gene and the Risk of Unexplained Recurrent Spontaneous Abortion.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets