Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Complete Genome Sequence of a Novel Strain of Infectious Bronchitis Virus, Isolated from Chickens in China in 2016.

ABSTRACT: An avian infectious bronchitis virus (IBV) was detected from trachea swabs of chickens in Hubei province, China, in 2016. The complete genome of the IBV strain, CK/CH/HB/2016, was characterized and analyzed to better understand IBV epidemiology in China.

SUBMITTER: Li TT

PROVIDER: S-EPMC5679815 | biostudies-literature | 2017 Nov

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Complete Genome Sequence of a Novel Strain of Infectious Bronchitis Virus, Isolated from Chickens in China in 2016.

Li Ting-Ting TT Li Jin-Yan JY Huang Tao T Ge Xing-Yi XY

Genome announcements 20171109 45

An avian infectious bronchitis virus (IBV) was detected from trachea swabs of chickens in Hubei province, China, in 2016. The complete genome of the IBV strain, CK/CH/HB/2016, was characterized and analyzed to better understand IBV epidemiology in China. ...[more]

PMID: 29122882

Similar Datasets

Complete genome sequence of a nephropathogenic infectious bronchitis virus strain isolated in china.

Project description:Infectious bronchitis virus (IBV) causes tremendous economic losses to the poultry industry. Here, we report the complete genome analysis results for a new natural recombination nephropathogenic IBV strain named SAIBK, which was isolated in the Sichuan province of China in 2005.

| S-EPMC3795213 | biostudies-literature

Complete genome sequence of a recombinant nephropathogenic infectious bronchitis virus strain in China.

Project description:Recently, nephropathogenic infectious bronchitis virus (IBV) outbreaks have occurred in commercial broiler flocks and have been associated with a high incidence and morbidity in China. The CK/CH/Zhejiang/06/10 strain (IBV-YX10) was isolated from a 12-day-old broiler chicken in a flock of chickens with swollen speckled kidneys and distended ureters filled with uric acid in China in 2010. Here we reported the complete genomic sequence of the IBV-YX10 which was a natural recombinant nephropathogenic infectious bronchitis virus strain. These findings will contribute additional insights into the molecular characteristics of evolving IBV genomes and the need for effective control of IBV in China.

| S-EPMC3503108 | biostudies-literature

Complete Genome Sequence of Infectious Bronchitis Virus Strain JP/KH/64, Isolated in Japan.

Project description:Here, we report the complete genome sequence of infectious bronchitis virus (IBV) strain JP/KH/64, which is the reference strain for the JP-I genotype in Japan. This information should be useful for an in-depth understanding of the evolution of the JP-I genotype.

| S-EPMC8496369 | biostudies-literature

Complete genome sequence analysis of a predominant infectious bronchitis virus (IBV) strain in China.

Project description:Infectious bronchitis (IB) is one of the major diseases in poultry flocks all over the world caused by infectious bronchitis virus (IBV). In the study, the complete genome sequence of strain A2 was sequenced and analyzed, which was a predominant IBV strain in China. The results indicated that there were mutations, insertions, and deletions distributed in the whole genome. The A2 virus had the highest identity to S14 and BJ in terms of full genome, whereas had a further distance to Massachusetts strains. Phylogenetic analysis showed that A2 isolate clustered together with most Chinese strains. The results of this study suggest that strain A2 may play an important role in IBV's evolution and A2-like IBVs are predominant strains in China.

| S-EPMC7089031 | biostudies-literature

Near-Complete Genome Sequence of Infectious Bronchitis Virus Strain VFAR-047 (GI-16 Lineage), Isolated in Peru.

Project description:Here, we report the near-complete genome sequence of the infectious bronchitis virus (IBV) strain VFAR-047, isolated in Peru in 2014. This strain was classified into GI lineage 16 (GI-16) based on both the genome and Spike 1 (S1) sequence analysis. Furthermore, four potential recombination events with other GI-16 and GI-11 strains were identified.

| S-EPMC6357641 | biostudies-literature

Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis.

Project description:One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.

| S-EPMC7165564 | biostudies-literature

Complete genome sequence of a novel infectious bronchitis virus strain circulating in China with a distinct S gene.

Project description:An avian infectious bronchitis virus (IBV) was isolated and identified from a commercial layer flock vaccinated with live attenuated H120 vaccine in China, designed as ck/CH/IBTZ/2012. To determine the origination and evolution of this isolated strain, we have carried out a complete genome sequencing of this strain. The genome of the ck/CH/IBTZ/2012 strain is 27,691 nucleotides in length and includes more than 10 open reading frames. Sequence comparison and phylogenetic analysis based on the full-length genomic sequences showed that ck/CH/IBTZ/2012 is mostly related to the LX4-like strains. However, sequence analysis based on the spike protein (S) gene sequences revealed that ck/CH/IBTZ/2012 possesses a distinct S gene setting it apart from the Massachusetts-type strains and LX4-type strains. The cleavage site within the spike protein (S) of ck/CH/IBTZ/2012 is HRRKR, which is different from the majority of the IBVs in China for their cleavage sits are HRRRR. Recombination analysis showed that ck/CH/IBTZ/2012 is a chimeric virus with a LX4-like backbone except S gene which might be from an unknown strain. Based on the data presented in this paper, it can be concluded that genetic changes due to adaptive evolution and recombination both contributed to the origin of strain ck/CH/IBTZ/2012, which belongs to a new genotype.

| S-EPMC7089373 | biostudies-literature

Infectious bronchitis virus from chickens in Al-Hasa, Saudi Arabia 2015-2016.

Project description:AimThis study aimed to isolate some of the currently circulating infectious bronchitis virus (IBV) strains from some broiler chicken farms in Al-Hasa and to do some molecular characteristics of these strains.Materials and methodsWe collected 300 tissue specimens, including the trachea, bronchi, lungs, and kidneys from some four commercial chicken farms showing respiratory manifestations. We tested these tissue specimens by the real-time polymerase chain reaction (RT-PCR) and gel-based PCR. We selected some PCR positive samples for isolation in the embryonated chicken eggs (ECE). We sequenced some PCR-positive samples and conducted phylogenetic analysis based on the obtained sequences.ResultsOur molecular surveillance revealed that 31.6% of the tested specimens were IBV positive by PCR. We selected some positive specimens showing low Ct values by the qRT-PCR for virus isolation by the ECE. The infected eggs showed hemorrhage, dwarfing, and death in some cases after three passages in the ECE. We sequenced some of the positive PCR specimens and used the obtained sequences to draw the phylogenetic tree based on the partial IBV-ORF-1a, N, and S1 gene sequences. The phylogenetic trees based on the IBV-N and S1 gene sequences showed that the circulating IBV strains in Al-Hasa during 2016 was showing a high degree of identity to some strains from Taiwan and Italy. Meanwhile, the grouping of these strains based on the IBV-S1 sequences revealed that the currently circulating IBV strains in Al-Hasa belonged to Gr.I.7 along with strains from Taiwan.ConclusionOur results confirmed the continuous circulation of the IBV among the chicken population in Al-Hasa despite the intensive application of vaccines against this virus.

| S-EPMC6487242 | biostudies-literature

Molecular characterization of an infectious bronchitis virus strain isolated from northern China in 2012.

Project description:This study reports the complete genome sequence of an infectious bronchitis virus (CK/CH/SD/121220, KJ128295) isolated in 2012 from Shandong Province in northern China. The genome is 27,666 nt long, comprising six genes and 5' and 3' untranslated regions. The full-length genome of the CK/CH/SD/121220 isolate had the highest nucleotide sequence identity (96.7 %) to the YX10 strain. Sites of recombination were identified in the genes 1ab, S, 5a, 5b and N, with their putative parental strains belonging to the QX- and YN-type subgroups, which are already circulating in China. Our findings suggest an important role played by recombination in IBV evolution.

| S-EPMC7086801 | biostudies-literature

Complete genome sequence and recombination analysis of infectious bronchitis virus attenuated vaccine strain H120.

Project description:The strain H120 of infectious bronchitis virus (IBV) is one of the earliest and representative attenuated live Infectious Bronchitis vaccine strains. To investigate the genomic feature of H120 and further understand its role in the epidemiology of IBV, complete genome of H120 was sequenced and compared with sequences of other IBV strains by phylogenetic and recombination analysis. The complete genome of H120 is 27631 nucleotides in length and has a similar structure with that of Beaudette strain. We found that strain ZJ971 is probably a virulence revertant of H120. Nine amino acids changes and a three-nucleotide deletion were identified in ZJ971. Besides, potential recombination events associated with H120 were found in five IBV strains including H52, KQ6, SAIBK, Ark DPI 11, and Ark DPI 101. This study suggested that H120 might have contributed to the emergence of new IBV variants through both virulence reversion and recombination.

| S-EPMC7089309 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data