Browse
Submit Data
Databases
API
Help

Dataset Information

20 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Lymphocytes eject interferogenic mitochondrial DNA webs in response to CpG and non-CpG oligodeoxynucleotides of class C.

ABSTRACT: Circulating mitochondrial DNA (mtDNA) is receiving increasing attention as a danger-associated molecular pattern in conditions such as autoimmunity, cancer, and trauma. We report here that human lymphocytes [B cells, T cells, natural killer (NK) cells], monocytes, and neutrophils derived from healthy blood donors, as well as B cells from chronic lymphocytic leukemia patients, rapidly eject mtDNA as web filament structures upon recognition of CpG and non-CpG oligodeoxynucleotides of class C. The release was quenched by ZnCl₂, independent of cell death (apoptosis, necrosis, necroptosis, autophagy), and continued in the presence of TLR9 signaling inhibitors. B-cell mtDNA webs were distinct from neutrophil extracellular traps concerning structure, reactive oxygen species (ROS) dependence, and were devoid of antibacterial proteins. mtDNA webs acted as rapid (within minutes) messengers, priming antiviral type I IFN production. In summary, our findings point at a previously unrecognized role for lymphocytes in antimicrobial defense, utilizing mtDNA webs as signals in synergy with cytokines and natural antibodies, and cast light on the interplay between mitochondria and the immune system.

SUBMITTER: Ingelsson B

PROVIDER: S-EPMC5776968 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

The control region of mitochondrial DNA shows an unusual CpG and non-CpG methylation pattern.

Project description:DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question.

| S-EPMC3859322 | biostudies-literature

Human mitochondrial DNA is extensively methylated in a non-CpG context.

Project description:Mitochondrial dysfunction plays critical roles in cancer development and related therapeutic response; however, exact molecular mechanisms remain unclear. Recently, alongside the discovery of mitochondrial-specific DNA methyltransferases, global and site-specific methylation of the mitochondrial genome has been described. Investigation of any functional consequences however remains unclear and debated due to insufficient evidence of the quantitative degree and frequency of mitochondrial DNA (mtDNA) methylation. This study uses WGBS to provide the first quantitative report of mtDNA methylation at single base pair resolution. The data show that mitochondrial genomes are extensively methylated predominantly at non-CpG sites. Importantly, these methylation patterns display notable differences between normal and cancer cells. Furthermore, knockdown of DNA methyltransferase enzymes resulted in a marked global reduction of mtDNA methylation levels, indicating these enzymes may be associated with the establishment and/or maintenance of mtDNA methylation. DNMT3B knockdown cells displayed a comparatively pronounced global reduction in mtDNA methylation with concomitant increases in gene expression, suggesting a potential functional link between methylation and gene expression. Together these results demonstrate reproducible, non-random methylation patterns of mtDNA and challenge the notion that mtDNA is lowly methylated. This study discusses key differences in methodology that suggest future investigations must allow for techniques that assess both CpG and non-CpG methylation.

| S-EPMC6821263 | biostudies-literature

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

CpG Oligodeoxynucleotides Downregulate Placental Adiponectin and Increase Embryo Loss in Non-Obese Diabetic Mice.

Project description:ProblemCpG oligodeoxynucleotides (ODNs) can induce immunological changes in non-obese diabetic (NOD) mice and increase embryo loss, but little is known about the mechanism. This study aimed to determine the role of adiponectin in CpG ODN-induced pregnancy failure.Method of studyOligodeoxynucleotide 1826 was intraperitoneally injected to NOD mice, and ODN 2216, ODN 2006, and ODN 2395 were used to stimulate human trophoblast cell lines to investigate adiponectin expression patterns and its possible effects on trophoblast function.ResultsCpG ODNs downregulated adiponectin via the cJun N-terminal kinase signaling pathway and led to increased embryo loss (from 6.9 to 33.3%). ODN 2006 impaired human trophoblast cell migration, which was successfully rescued by adiponectin treatment.ConclusionCpG ODNs decreased placental adiponectin expression in NOD mice and impaired human trophoblast function and was associated with increased embryo loss. Adiponectin may therefore play an important protective role in the prevention of bacteria-induced pregnancy failure.

| S-EPMC5074278 | biostudies-literature

CpG and non-CpG oligodeoxynucleotides directly costimulate mouse and human CD4+ T cells through a TLR9- and MyD88-independent mechanism.

Project description:TLR ligands are known to activate APCs, but direct T cell responsiveness to TLR ligands is controversial. Because of their clinical relevance, we performed in-depth studies of the effects of the TLR9-associated ligands, oligodeoxynucleotides (ODNs), on highly purified T lymphocytes. Both CpG and non-CpG ODNs directly costimulate mouse and human CD4(+) T cells, resulting in activation marker upregulation, cytokine secretion, elevated TCR phosphorylation, and proliferation. Surprisingly, ODN costimulation occurred independently of TLR9 and MyD88, as well as ICOS, CD28, and TRIF. TLR9-antagonist ODNs likewise promoted T cell activation, which has important implications for the study of these "inhibitory" ODNs in inflammatory diseases. Cytokine profiling revealed that ODNs promote polarization of distinct Th subsets, and that ODNs differentially affect human naive and memory T cells. Our studies reveal a striking and unexpected ability of ODNs to directly activate and polarize T cells, presenting an opportunity to enhance the paradigm for selection of therapeutic ODNs in humans.

| S-EPMC3169723 | biostudies-literature

CpG Oligodeoxynucleotides Enhance the Activities of CD8+ Cytotoxic T-Lymphocytes Generated by Combined hMUC1 Vaccination and hNIS Radioiodine Gene Therapy.

Project description:PurposeThe authors evaluated whether the cytotoxicity of CD8+CTLs generated by combined hMUC1 vaccination and hNIS radioiodine gene therapy was enhanced in the presence of CpG in an established tumor model.MethodsCMNF cells (CT26 cells expressing hMUC1, hNIS and Firefly luciferase) were transplanted into BALB/c mice. Four and 10 days later, tumor-bearing mice were immunized intramuscularly with pcDNA3.1 or pcDNA-hMUC1 or pcDNA-hMUC1+CpG, and subsequently administered PBS or (131)I [five groups (seven mice/group): referred to as the pcDNA3.1+PBS, phMUC1+PBS, pcDNA3.1+(131)I, phMUC1+(131)I, and phMUC1+(131)I+CpG groups]. The number of CD8+IFNr+ T cells of splenocytes as well as the number of CD8+IFNr+ T cells of splenocytes re-stimulated with CD11c+ cells was determined using FACS analysis. The activities of cytotoxic T cells (CTLs) from splenocytes were investigated.ResultsMarked tumor growth inhibition was observed in the phMUC1+(131)I and phMUC1+(131)I+CpG groups, but not in the other three single therapy groups. Particularly the number of CD8+IFN-γ+ T cells of splenocytes was more increased in the phMUC1+(131)I+CpG group than in the phMUC1+(131)I group. The number of CD8+IFN-γ+ T cells of splenocytes stimulated with CD11c+ cells was the most enhanced in the phMUC1+(131)I+CpG group among the five groups. Concurrently, the activities of hMUC1-associated CTLs obtained from splenocytes in the phMUC1+(131)I+CpG group were significantly greater than in the other four groups (pcDNA+PBS, phMUC1+PBS, pcDNA+(131)I, phMUC1+(131)I, and phMUC1+(131)I+CpG, 16 ± 2%, 20 ± 1%, 30 ± 2%, 60 ± 2%, and 87 ± 2%, respectively, P < 0.01).ConclusionOur data suggest that adjuvant CpG ODNs can increase the killing activities of CTLs generated by combined hMUC1 DNA vaccination and hNIS radioiodine gene therapy.

| S-EPMC4042931 | biostudies-literature

CpG-Oligodeoxynucleotides Alleviate Tert-Butyl Hydroperoxide-Induced Macrophage Apoptosis by Regulating Mitochondrial Function and Suppressing ROS Production.

Project description:Oxidative stress and mitochondrial dysfunction are related to disease pathogenesis. Oligodeoxynucleotide containing CpG motifs (CpG ODN) demonstrate possibilities for immunotherapy applications. The aim of the present work is to explore the underlying mechanism of the cytoprotective function of CpG ODN by employing the oxidative stress modulation in immune cells. We used the imaging flow cytometry to demonstrate that tert-butyl hydroperoxide (t-BHP) induces mitochondrial-mediated apoptosis and ROS production in RAW264.7 cells. After pretreatment with CpG ODN, the percentage of apoptotic cells and ROS production was both markedly reduced. The decrease in mitochondrial membrane potential (MMP) induced by t-BHP was partially reversed by CpG ODN. The t-BHP induced upregulation of the expression of apoptosis-related proteins (cleaved-caspase 3, cleaved-caspase 9, cleaved-PARP, and bax) was notably decreased in the presence of CpG ODN. Furthermore, we found that CpG ODN enhanced phosphorylation of ERK1/2 and Akt to inhibit ROS production. In conclusion, the protective effect of CpG ODN in mitigation of t-BHP-induced apoptosis is dependent on the reduction of ROS.

| S-EPMC7232733 | biostudies-literature

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

Project description:Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

| S-EPMC4060301 | biostudies-literature

CpG methylation patterns of human mitochondrial DNA.

Project description:The epigenetic modification of mitochondrial DNA (mtDNA) is still in controversy. To clarify this point, we applied the gold standard method for DNA methylation, bisulfite pyrosequencing, to examine human mtDNA methylation status. Before bisulfite conversion, BamHI was used to digest DNA to open the loop of mtDNA. The results demonstrated that the linear mtDNA had significantly higher bisulfite conversion efficiency compared with circular mtDNA. Furthermore, the methylation values obtained from linear mtDNA were significantly lower than that of circular mtDNA, which was verified by SEQUENOM MassARRAY. The above impacts of circular structure were also observed in lung DNA samples but not in saliva DNA samples. Mitochondrial genome methylation of blood samples and saliva samples from 14 unrelated individuals was detected. The detected regions covered 83 CpG sites across mtDNA including D-loop, 12 S rRNA, 16 S rRNA, ND1, COXI, ND3, ND4, ND5, CYTB. We found that the average methylation levels of nine regions were all less than 2% for both sample types. In conclusion, our findings firstly show that the circular structure of mtDNA affects bisulfite conversion efficiency, which leads to overestimation of mtDNA methylation values. CpG methylation in human mtDNA is a very rare event at most DNA regions.

| S-EPMC4800444 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data