Dataset Information

Development of an RNA interference (RNAi) gene knockdown protocol in the anaerobic gut fungus Pecoramyces ruminantium strain C1A.

ABSTRACT: Members of the anaerobic gut fungi (AGF) reside in rumen, hindgut, and feces of ruminant and non-ruminant herbivorous mammals and reptilian herbivores. No protocols for gene insertion, deletion, silencing, or mutation are currently available for the AGF, rendering gene-targeted molecular biological manipulations unfeasible. Here, we developed and optimized an RNA interference (RNAi)-based protocol for targeted gene silencing in the anaerobic gut fungus Pecoramyces ruminantium strain C1A. Analysis of the C1A genome identified genes encoding enzymes required for RNA silencing in fungi (Dicer, Argonaute, Neurospora crassa QDE-3 homolog DNA helicase, Argonaute-interacting protein, and Neurospora crassa QIP homolog exonuclease); and the competency of C1A germinating spores for RNA uptake was confirmed using fluorescently labeled small interfering RNAs (siRNA). Addition of chemically-synthesized siRNAs targeting D-lactate dehydrogenase (ldhD) gene to C1A germinating spores resulted in marked target gene silencing; as evident by significantly lower ldhD transcriptional levels, a marked reduction in the D-LDH specific enzymatic activity in intracellular protein extracts, and a reduction in D-lactate levels accumulating in the culture supernatant. Comparative transcriptomic analysis of untreated versus siRNA-treated cultures identified a few off-target siRNA-mediated gene silencing effects. As well, significant differential up-regulation of the gene encoding NAD-dependent 2-hydroxyacid dehydrogenase (Pfam00389) in siRNA-treated C1A cultures was observed, which could possibly compensate for loss of D-LDH as an electron sink mechanism in C1A. The results demonstrate the feasibility of RNAi in anaerobic fungi, and opens the door for gene silencing-based studies in this fungal clade.

SUBMITTER: Calkins SS

PROVIDER: S-EPMC5796279 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Background. The anaerobic gut fungi (phylum Neocallimastigomycota) represent a promising source of novel lignocellulolytic enzymes. Here, we report on the cloning, expression, and characterization of a glycoside hydrolase family 39 (GH39) enzyme (Bgxg1) that is highly transcribed by the anaerobic fungus Orpinomycessp. strain C1A under different growth conditions. This represents the first study of a GH39-family enzyme from the anaerobic fungi. Methods. Using enzyme activity assays, we performed a biochemical characterization of Bgxg1 on a variety of substrates over a wide range of pH and temperature values to identify the optimal enzyme conditions and the specificity of the enzyme. In addition, substrate competition studies and comparative modeling efforts were completed. Results. Contrary to the narrow range of activities (β-xylosidase or α-L-iduronidase) observed in previously characterized GH39 enzymes, Bgxg1 is unique in that it is multifunctional, exhibiting strong β-xylosidase, β-glucosidase, β-galactosidase activities (11.5 ± 1.2, 73.4 ± 7.15, and 54.6 ± 2.26 U/mg, respectively) and a weak xylanase activity (10.8 ± 1.25 U/mg), as compared to previously characterized enzymes. Further, Bgxg1 possesses extremely high affinity (as evident by the lowest K m values), compared to all previously characterized β-glucosidases, β-galactosidases, and xylanases. Physiological characterization revealed that Bgxg1 is active over a wide range of pH (3-8, optimum 6) and temperatures (25-60 °C, optimum 39 °C), and possesses excellent temperature and thermal stability. Substrate competition assays suggest that all observed activities occur at a single active site. Using comparative modeling and bioinformatics approaches, we putatively identified ten amino acid differences between Bgxg1 and previously biochemically characterized GH39 β-xylosidases that we speculate could impact active site architecture, size, charge, and/or polarity. Discussion. Collectively, the unique capabilities and multi-functionality of Bgxg1 render it an excellent candidate for inclusion in enzyme cocktails mediating cellulose and hemicellulose saccharification from lignocellulosic biomass.

Project description:Focal adhesions (FAs) are large eukaryotic multiprotein complexes that are present in all metazoan cells and function as stable sites of tight adhesion between the extracellular matrix (ECM) and the cell's cytoskeleton. FAs consist of anchor membrane protein (integrins), scaffolding proteins (e.g. α-actinin, talin, paxillin, and vinculin), signaling proteins of the IPP complex (e.g. integrin-linked kinase, α-parvin, and PINCH), and signaling kinases (e.g. focal adhesion kinase (FAK) and Src kinase). While genes encoding complete focal adhesion machineries are present in genomes of all multicellular Metazoa; incomplete machineries were identified in the genomes of multiple non-metazoan unicellular Holozoa, basal fungal lineages, and amoebozoan representatives. Since a complete FA machinery is required for functioning, the putative role, if any, of these incomplete FA machineries is currently unclear. We sought to examine the expression patterns of FA-associated genes in the anaerobic basal fungal isolate Orpinomyces sp. strain C1A under different growth conditions and at different developmental stages. Strain C1A lacks clear homologues of integrin, and the two signaling kinases FAK and Src, but encodes for all scaffolding proteins, and the IPP complex proteins. We developed a protocol for synchronizing growth of C1A cultures, allowing for the collection and mRNA extraction from flagellated spores, encysted germinating spores, active zoosporangia, and late inactive sporangia of strain C1A. We demonstrate that the genes encoding the FA scaffolding proteins α-actinin, talin, paxillin, and vinculin are indeed transcribed under all growth conditions, and at all developmental stages of growth. Further, analysis of the observed transcriptional patterns suggests the putative involvement of these components in alternative non-adhesion-specific functions, such as hyphal tip growth during germination and flagellar assembly during zoosporogenesis. Based on these results, we propose putative alternative functions for such proteins in the anaerobic gut fungi. Our results highlight the presumed diverse functionalities of FA scaffolding proteins in basal fungi.

Project description:BACKGROUND:Anaerobic fungi reside in the rumen and alimentary tract of herbivores where they play an important role in the digestion of ingested plant biomass. The anaerobic fungal isolate Orpinomyces sp. strain C1A is an efficient biomass degrader, capable of simultaneous saccharification and fermentation of the cellulosic and hemicellulosic fractions in multiple types of lignocellulosic biomass. To understand the mechanistic and regulatory basis of biomass deconstruction in anaerobic fungi, we analyzed the transcriptomic profiles of C1A when grown on four different types of lignocellulosic biomass (alfalfa, energy cane, corn stover, and sorghum) versus a soluble sugar monomer (glucose). RESULTS:A total of 468.2 million reads (70.2 Gb) were generated and assembled into 27,506 distinct transcripts. CAZyme transcripts identified included 385, 246, and 44 transcripts belonging to 44, 13, and 8 different glycoside hydrolases (GH), carbohydrate esterases, and polysaccharide lyases families, respectively. Examination of CAZyme transcriptional patterns indicates that strain C1A constitutively transcribes a high baseline level of CAZyme transcripts on glucose. Although growth on lignocellulosic biomass substrates was associated with a significant increase in transcriptional levels in few GH families, including the highly transcribed GH1 ?-glucosidase, GH6 cellobiohydrolase, and GH9 endoglucanase, the transcriptional levels of the majority of CAZyme families and transcripts were not significantly altered in glucose-grown versus lignocellulosic biomass-grown cultures. Further, strain C1A co-transcribes multiple functionally redundant enzymes for cellulose and hemicellulose saccharification that are mechanistically and structurally distinct. Analysis of fungal dockerin domain-containing transcripts strongly suggests that anaerobic fungal cellulosomes represent distinct catalytic units capable of independently attacking and converting intact plant fibers to sugar monomers. CONCLUSIONS:Collectively, these results demonstrate that strain C1A achieves fast, effective biomass degradation by the simultaneous employment of a wide array of constitutively-transcribed cellulosome-bound and free enzymes with considerable functional overlap. We argue that the utilization of this indiscriminate strategy could be justified by the evolutionary history of anaerobic fungi, as well as their functional role within their natural habitat in the herbivorous gut.

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Dataset Information

Development of an RNA interference (RNAi) gene knockdown protocol in the anaerobic gut fungus Pecoramyces ruminantium strain C1A.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets