A Preliminary Exploration of the Application of Self-Compassion Within the Context of Sport Injury.
Ontology highlight
ABSTRACT:
SUBMITTER: Huysmans Z
PROVIDER: S-EPMC5916815 | biostudies-literature | 2017 Feb
REPOSITORIES: biostudies-literature
Publications
A Preliminary Exploration of the Application of Self-Compassion Within the Context of Sport Injury.
Huysmans Zenzi Z Clement Damien D
Journal of sport & exercise psychology 20170201 1
In a prospective study of collegiate athletes (N = 117), the application of self-compassion within the context of sport injury was explored. Previous literature indicated that self-compassion enhances adaptive coping and well-being and reduces anxiety in stress-provoking situations. This research suggested that it could potentially reduce the stress response and subsequent injury risk. Findings indicated that self-compassion may buffer the experience of somatic anxiety (rs = -.436, p < .01) and ...[more]
Similar Datasets
Project description:The adolescent developmental stage is characterized by multiple transitions, both physiological and environmental, and physical, cognitive and socioemotional growth that often leads to both challenges and opportunities. Developing coping strategies to contend with these challenges, such as strengthening resilience and being open to new experiences, can potentially facilitate traversing this developmental period with greater ease. Although previous research has supported the premise that self-compassion buffers the negative effects of these emotional challenges, little research to date has examined the link between strengths-based attributes such as resilience and curiosity/exploration (i.e., being open to and embracing new experiences) and self-compassion, and whether age or gender moderates these relationships. As such, the purpose of this study was to explore these relationships among a large adolescent sample. Results of 786 public school adolescents and 271 private school adolescents (68% white, 65% female, Mage=15.6) who responded to questions in an online survey indicated that self-compassion was positively associated with both curiosity/exploration and resilience, and gender moderated the relationship between self-compassion and resilience such that this association was stronger among males than females. Age did not moderate the relationship between self-compassion and either resilience or curiosity/exploration, indicating that self-compassion is associated with both resilience and curiosity/exploration at all ages across adolescence. Implications are that interventions that cultivate self-compassion among adolescents may strengthen resilience and curiosity/exploration, offering new and healthy ways to cope with these challenges leading to improved emotional well-being.
| S-EPMC8168452 | biostudies-literature
Project description:The Self-Compassion Scale (SCS) is currently the only self-report instrument to measure self-compassion. The SCS is widely used despite the limited evidence for the scale's psychometric properties, with validation studies commonly performed in college students. The current study examined the factor structure, reliability, and construct validity of the SCS in a large representative sample from the community. The study was conducted in 1,736 persons, of whom 1,643 were included in the analyses. Besides the SCS, data was collected on positive and negative indicators of psychological functioning, as well as on rumination and neuroticism. Analyses included confirmatory factor analyses (CFA), exploratory factor analyses (EFA), and correlations. CFA showed that the SCS's proposed six-factor structure could not be replicated. EFA suggested a two-factor solution, formed by the positively and negatively formulated items respectively. Internal consistency was good for the two identified factors. The negative factor (i.e., sum score of the negatively formulated items) correlated moderately to strongly to negative affect, depressive symptoms, perceived stress, as well as to rumination and neuroticism. Compared to this negative factor, the positive factor (i.e., sum score of the positively formulated items) correlated weaker to these indicators, and relatively more strongly to positive affect. Results from this study do not justify the common use of the SCS total score as an overall indicator of self-compassion, and provide support for the idea, as also assumed by others, that it is important to make a distinction between self-compassion and self-criticism.
| S-EPMC4508060 | biostudies-other
Project description:Acceptance and commitment therapy (ACT), based on the Psychological Flexibility (PF) model, has been recently applied to fibromyalgia (FM), and appeared effective in improving functioning. However, evidence for some of the processes within the PF model, self-as-context (SAC) in particular, is lacking within this population. The current study validates a measure of SAC, the Self Experiences Questionnaire (SEQ), and preliminarily investigates the role of SAC in relation to functioning in FM. Participants (N = 298, 93.3% women) self-reporting a diagnosis of FM were recruited via the Internet and completed an online survey. Measures included pain, pain acceptance and SAC, as processes, and pain interference, work and social adjustment, depression and depression-related interference, as outcomes. Confirmatory factor analysis of the SEQ suggested a bi-factor structure, with a general factor underlying all items and two sub-factors, self-as-distinction and self-as-observer (χ2 = 46.55, p = .06, comparative fit index (CFI) = .99, Tucker-Lewis Index (TLI) = .99, root mean square error of approximation (RMSEA) = .04). Component factors showed good reliability, Cronbach's α = .90, and construct validity, supported by significant Pearson's correlations between SEQ scores, acceptance and outcomes (r = -.14 to -.33). In multiple regression analyses, SEQ scores significantly predicted pain-related interference (β = -.17, p < .05), work and social adjustment (β = -.14, p < .05) and depression (β = -.21, p < .01), but not depression-related interference, after controlling for pain, but only significantly predicted depression after controlling pain acceptance. These preliminary results show potentially important associations between SAC and functioning in people with FM.
| S-EPMC5521349 | biostudies-other
Project description:The purpose of the study is to investigate whether the oxygen uptake and heart rate at rest, in Greek professional soccer players, are affected by recent injuries, as well as how sleep quality is affected. Forty-two male professional soccer players were included in the study and divided into two groups: injurygroup (n = 22, age: 21.6 ± 5.4 years, body fat: 11.0 ± 3.9%, total body water: 64.0 ± 2.5%) and no-injurygroup (n = 20, age: 24.2 ± 5.6 years, body fat: 10.1 ± 2.8%, total body water: 64.3 ± 1.8%). The oxygen uptake at rest (VO2resting, mL/min/kg) and heart rate (HR, bpm) were recorded in the upright position for 3 min, and the predicted values were calculated. One hour before, the athletes answered the Pittsburgh Sleep Quality Index (PSQI) questionnaire. The results showed a difference between groups (injurygroup vs. no-injurygroup) in VO2resting (7.5 ± 1.4 vs. 5.5 ± 1.2 mL/min/kg, p < 0.001) and percent of predicted values (92.5 ± 17.2 vs. 68.3 ± 14.6%, p < 0.001) and HR, such as beats per min (100.6 ± 12.8 vs. 93.1 ± 4.6 bpm, p = 0.001), percent of predicted values (50.7 ± 6.4 vs. 47.6 ± 2.8%, p = 0.003) and sleep quality score (PSQI: 4.9 ± 2.2 vs. 3.1 ± 0.9, p = 0.005). Anthropometric characteristics were not different between groups. Oxygen consumption and heart rate at rest are affected by the systemic adaptations due to injury. These pathophysiological changes probably relate to increased blood flow in an attempt to restore the injury area.
| S-EPMC7370061 | biostudies-literature
Project description:Volunteers have played an important role by supporting essential services that have been overwhelmed during the most critical moments of the SARS-CoV-2 pandemic. Hence, nonprofit organizations may be interested in preventing negative consequences of these volunteers' exposure to potentially traumatic events. The aim of this cross-sectional study was twofold. First, to examine to what extent self-compassion and self-determination would contribute to differentiating between volunteers with different levels of compassion fatigue, compassion satisfaction, and post-traumatic growth. Second, to identify the best predictors of the most extreme levels of each outcome. Participants were 211 Spanish Red Cross volunteers (60.7% women), who completed a survey. They were separately classified into three groups (low, medium, and high) according to the 33rd and 66th percentile scores on each outcome (compassion fatigue, compassion satisfaction, and post-traumatic growth). Univariate analyses of variance and post-hoc comparisons revealed that self-compassion and self-determination contributed differently to distinguishing between levels of each outcome. Volunteers lowest in compassion fatigue stood out for showing fewer non-compassionate strategies and more mindfulness than the other groups. Moreover, those higher in satisfaction compassion also showed lower use of unhealthy strategies and higher scores in all other predictive variables. Volunteers highest in post-traumatic growth showed higher self-kindness and satisfaction of all psychological needs. Binary logistic regressions allowed for the identification of predictors of belonging to the most extreme groups. The protective factors may be useful to guide volunteers' self-care and help them thrive in the face of critical service demands.
| S-EPMC8409613 | biostudies-literature
Project description:BackgroundCompassion is intrinsically situated within particular contexts and how these contexts can shape compassion has not been well-described.ObjectiveThe purpose of the study was to describe how individual and contextual challenges can impact compassion within critical care and palliative care settings.DesignThis qualitative study adopted phenomenology and autoethnography to inform data collection, and principles of activity theory and realist inquiry for data interpretation.ParticipantsFive clinicians who work in critical care (n = 3) and palliative care (n = 3) participated in the study.ApproachQualitative data were obtained from ethnographic observations, interviews, and focus groups. Participants observed and recorded field notes (n = 53) on instances of suffering and compassion in their workplace settings. At the end of the study period, they participated in a focus group or individual interview to reflect on their experiences. Data was analyzed using constructivist grounded theory techniques and iteratively synthesized through group discussion and model building.Key resultsThe findings reflected four phenomena associated with compassion in context: individual gaps and lapses in compassion, relational challenges, contextual constraints on compassion, and distributed compassion. Individual gaps and lapses in compassion involved inattention, intention vs. perception, personal capacity, and personal toll. Relational challenges included receptivity, fragmentation, and lack of shared understanding. Contextual constraints consisted of situational pressures, the clinical environment, gaps in education, and organizational culture. The distribution of compassion within teams and how teams adapt their behaviors in response to perceived needs for greater compassion modulated these challenges.ConclusionsThe study illustrates the many ways in which compassion can be shaped by context and highlights the role of teamwork in identifying gaps and lapses in compassion and responding in a way that supports patients, families, and colleagues.
| S-EPMC6957623 | biostudies-literature
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:Self-compassion is natural, trainable and multi-faceted human capacity. To date there has been little research into the role of culture in influencing the conceptual structure of the underlying construct, the relative importance of different facets of self-compassion, nor its relationships to cultural values. This study employed a cross-cultural design, with 4,124 participants from 11 purposively sampled datasets drawn from different countries. We aimed to assess the relevance of positive and negative items when building the self-compassion construct, the convergence among the self-compassion components, and the possible influence of cultural values. Each dataset comprised undergraduate students who completed the "Self-Compassion Scale" (SCS). We used a confirmatory factor analysis (CFA) approach to the multitrait-multimethod (MTMM) model, separating the variability into self-compassion components (self-kindness, common humanity, mindfulness), method (positive and negative valence), and error (uniqueness). The normative scores of the Values Survey Module (VSM) in each country, according to the cultural dimensions of individualism, masculinity, power distance, long-term orientation, uncertainty avoidance, and indulgence, were considered. We used Spearman coefficients (r s) to assess the degree of association between the cultural values and the variance coming from the positive and negative items to explain self-compassion traits, as well as the variance shared among the self-compassion traits, after removing the method effects produced by the item valence. The CFA applied to the MTMM model provided acceptable fit in all the samples. Positive items made a greater contribution to capturing the traits comprising self-compassion when the long-term orientation cultural value was higher (r s = 0.62; p = 0.042). Negative items did not make significant contributions to building the construct when the individualism cultural value was higher, but moderate effects were found (r s = 0.40; p = 0.228). The level of common variance among the self-compassion trait factors was inversely related to the indulgence cultural value (r s = -0.65; p = 0.030). The extent to which the positive and negative items contribute to explain self-compassion, and that different self-compassion facets might be regarded as reflecting a broader construct, might differ across cultural backgrounds.
| S-EPMC6308155 | biostudies-literature
Project description:Health care professionals (HCPs) are a population at risk for high levels of burnout and compassion fatigue. The aim of the present systematic review was to give an overview on recent literature about mindfulness and compassion characteristics of HCPs, while exploring the effectiveness of techniques, involving the two aspects, such as MBSR or mindfulness intervention and compassion fatigue-related programs. A search of databases, including PubMed and PsycINFO, was conducted following the Preferred Reporting Items for Systematic Review and Meta-Analyses (PRISMA) guidelines and the methodological quality for this systematic review was appraised using AMSTAR-2 (A MeaSurement Tool to Assess systematic Reviews-2). The number of articles that met the inclusion criteria was 58 (4 RCTs, 24 studies with pre-post measurements, 12 cross-sectional studies, 11 cohort studies and 7 qualitative studies). MBSR intervention was effective at improving, and maintaining, mindfulness and self-compassion levels and to improve burnout, depression, anxiety, stress. The most frequently employed interventional strategies were mindfulness-related trainings that were effective at improving mindfulness and self-compassion, but not compassion fatigue, levels. Compassion-related interventions have been shown to improve self-compassion, mindfulness and interpersonal conflict levels. Mindfulness was effective at improving negative affect and compassion fatigue, while compassion satisfaction may be related to cultivation of positive affect. This systematic review summarized the evidence regarding mindfulness- and compassion-related qualities of HCPs as well as potential effects of MBSR, mindfulness-related and compassion-related interventions on professionals' psychological variables like mindfulness, self-compassion and quality of life. Combining structured mindfulness and compassion cultivation trainings may enhance the effects of interventions, limit the variability of intervention protocols and improve data comparability of future research.
| S-EPMC7412718 | biostudies-literature
Project description:The two studies presented in this article examine the relationships of personality traits and trait emotional intelligence (EI) with compassion and self-compassion in samples of Italian workers. Study 1 explored the relationship between trait EI and both compassion and self-compassion, controlling for the effects of personality traits in 219 workers of private Italian organizations. Hierarchical regression analyses revealed that trait EI explained variance beyond that accounted for by personality traits in relation to both compassion and self-compassion. Study 2 analyzed the contribution of trait EI in mediating the relationship between personality traits and both compassion and self-compassion of 231 workers from public Italian organizations with results supporting the mediating role of trait EI.
| S-EPMC7211602 | biostudies-literature