Dataset Information

Whole-exome Sequencing Helps the Diagnosis and Treatment in Children with Neurodevelopmental Delay Accompanied Unexplained Dyspnea.

ABSTRACT: Neurodevelopmental delay accompanied unexplained dyspnea is a highly lethal disease in clinic. This study is to investigate the performance characteristics of trio whole exome sequencing (Trio-WES) in a pediatric setting by presenting our patient cohort and displaying the diagnostic yield. A total of 31 pediatric patients showing neurodevelopmental delay accompanied unexplained dyspnea were admitted to our hospital and referred for molecular genetic testing using Trio-WES. Eight genes namely MMACHC, G6PC, G6PT, ETFDH, OTC, NDUFAF5, SLC22A5, and MAGEL2 were suspected to be responsible for the onset of the clinical symptoms and 6 variants were novel. Standard interpretation according to ACMG guideline showed that the variants were pathogenic. Finally, diagnosis of methylmalonic aciduria and homocystinuria, glycogen storage disease, ornithine transcarbamylase deficiency, glutaric acidemia II, mitochondrial complex 1 deficiency, carnitine deficiency, and Schaaf-Yang syndrome was made in 12 out of the 31 patients. Trio-WES is an effective means for molecular diagnosis of infantile neurodevelopmental delay accompanied unexplained dyspnea. As for molecular etiology identification, when routine potential monogenetic inheritance patterns including de novo, autosomal recessive, autosomal dominant, and X-linked recessive inheritance analysis is negative, physicians should take into account imprinted genes.

SUBMITTER: Tong W

PROVIDER: S-EPMC5980106 | biostudies-literature | 2018 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Whole-exome Sequencing Helps the Diagnosis and Treatment in Children with Neurodevelopmental Delay Accompanied Unexplained Dyspnea.

Tong Wenjia W Wang Yajian Y Lu Yun Y Ye Tongsheng T Song Conglei C Xu Yuanyuan Y Li Min M Ding Jie J Duan Yuanyuan Y Zhang Le L Gu Weiyue W Zhao Xiaoling X Yang Xiu-An XA Jin Danqun D

Scientific reports 20180326 1

Neurodevelopmental delay accompanied unexplained dyspnea is a highly lethal disease in clinic. This study is to investigate the performance characteristics of trio whole exome sequencing (Trio-WES) in a pediatric setting by presenting our patient cohort and displaying the diagnostic yield. A total of 31 pediatric patients showing neurodevelopmental delay accompanied unexplained dyspnea were admitted to our hospital and referred for molecular genetic testing using Trio-WES. Eight genes namely MMA ...[more]

PMID: 29581464

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:Inherited peripheral neuropathies (IPNs) are a group of related diseases primarily affecting the peripheral motor and sensory neurons. They include the hereditary sensory neuropathies (HSN), hereditary motor neuropathies (HMN), and Charcot-Marie-Tooth disease (CMT). Using whole-exome sequencing (WES) to achieve a genetic diagnosis is particularly suited to IPNs, where over 80 genes are involved with weak genotype-phenotype correlations beyond the most common genes. We performed WES for 110 index patients with IPN where the genetic cause was undetermined after previous screening for mutations in common genes selected by phenotype and mode of inheritance. We identified 41 missense sequence variants in the known IPN genes in our cohort of 110 index patients. Nine variants (8%), identified in the genes MFN2, GJB1, BSCL2, and SETX, are previously reported mutations and considered to be pathogenic in these families. Twelve novel variants (11%) in the genes NEFL, TRPV4, KIF1B, BICD2, and SETX are implicated in the disease but require further evidence of pathogenicity. The remaining 20 variants were confirmed as polymorphisms (not causing the disease) and are detailed here to help interpret sequence variants identified in other family studies. Validation using segregation, normal controls, and bioinformatics tools was valuable as supporting evidence for sequence variants implicated in disease. In addition, we identified one SETX sequence variant (c.7640T>C), previously reported as a putative mutation, which we have confirmed as a nonpathogenic rare polymorphism. This study highlights the advantage of using WES for genetic diagnosis in highly heterogeneous diseases such as IPNs and has been particularly powerful in this cohort where genetic diagnosis could not be achieved due to phenotype and mode of inheritance not being previously obvious. However, first tier testing for common genes in clinically well-defined cases remains important and will account for most positive results.

Dataset Information

Whole-exome Sequencing Helps the Diagnosis and Treatment in Children with Neurodevelopmental Delay Accompanied Unexplained Dyspnea.

Publications

Whole-exome Sequencing Helps the Diagnosis and Treatment in Children with Neurodevelopmental Delay Accompanied Unexplained Dyspnea.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets