Browse
Submit Data
Databases
API
Help

Dataset Information

17 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Ultrasensitive detection of telomerase activity in a single cell using stem-loop primer-mediated exponential amplification (SPEA) with near zero nonspecific signal.

ABSTRACT: Telomerase is a crucial biomarker for cancers. Its reliable and sensitive detection, particularly in a single cell, has great significance for the early diagnosis of cancers, studies on tumor progression and anticancer therapy, which remain a challenge, due to nonspecific amplification. Herein, we developed a novel stem-loop primer-mediated exponential amplification (SPEA) strategy, which can specifically and efficiently amplify the telomerase-elongated telomere repeat unit with near zero nonspecific signal. The SPEA-based assay can accurately detect telomerase activity in the crude lysate of a single cell and is suited for detecting the cellular heterogeneity arising from cell-to-cell variations.

SUBMITTER: Wang H

PROVIDER: S-EPMC6018513 | biostudies-literature | 2016 Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Ultrasensitive detection of telomerase activity in a single cell using stem-loop primer-mediated exponential amplification (SPEA) with near zero nonspecific signal.

Wang Honghong H Wang Hui H Liu Chenghui C Duan Xinrui X Li Zhengping Z

Chemical science 20160428 8

Telomerase is a crucial biomarker for cancers. Its reliable and sensitive detection, particularly in a single cell, has great significance for the early diagnosis of cancers, studies on tumor progression and anticancer therapy, which remain a challenge, due to nonspecific amplification. Herein, we developed a novel stem-loop primer-mediated exponential amplification (SPEA) strategy, which can specifically and efficiently amplify the telomerase-elongated telomere repeat unit with near zero nonspe ...[more]

PMID: 30155143

Similar Datasets

Proximity hybridization-mediated isothermal exponential amplification for ultrasensitive electrochemical protein detection.

Project description:In this study, we fabricated a novel electrochemical biosensing platform on the basis of target-triggered proximity hybridization-mediated isothermal exponential amplification reaction (EXPAR) for ultrasensitive protein analysis. Through rational design, the aptamers for protein recognition were integrated within two DNA probes. Via proximity hybridization principle, the affinity protein-binding event was converted into DNA assembly process. The recognition of protein by aptamers can trigger the strand displacement through the increase of the local concentrations of the involved probes. As a consequence, the output DNA was displaced, which can hybridize with the duplex probes immobilized on the electrode surface subsequently, leading to the initiation of the EXPAR as well as the cleavage of duplex probes. Each cleavage will release the gold nanoparticles (AuNPs) binding sequence. With the modification of G-quadruplex sequence, electrochemical signals were yielded by the AuNPs through oxidizing 3,3',5,5'-tetramethylbenzidine in the presence of H2O2. The study we proposed exhibited high sensitivity toward platelet-derived growth factor BB (PDGF-BB) with the detection limit of 52 fM. And, this method also showed great selectivity among the PDGF isoforms and performed well in spiked human serum samples.

| S-EPMC5566414 | biostudies-literature

CRISPR-Cas12a based internal negative control for nonspecific products of exponential rolling circle amplification.

Project description:False-positive results cause a major problem in nucleic acid amplification, and require external blank/negative controls for every test. However, external controls usually have a simpler and lower background compared to the test sample, resulting in underestimation of false-positive risks. Internal negative controls, performed simultaneously with amplification to monitor the background level in real-time, are therefore appealing in both research and clinic. Herein, we describe a nonspecific product-activated single-stranded DNA-cutting approach based on CRISPR (clustered regularly interspaced short palindromic repeats) Cas12a (Cpf1) nuclease. The proposed approach, termed Cas12a-based internal referential indicator (CIRI), can indicate the onset of nonspecific amplification in an exponential rolling circle amplification strategy here combined with an optomagnetic readout. The capability of CIRI as an internal negative control can potentially be extended to other amplification strategies and sensors, improving the performance of nucleic acid amplification-based methodologies.

| S-EPMC7049689 | biostudies-literature

Ultrasensitive loop mediated isothermal amplification (US-LAMP) to detect malaria for elimination.

Project description:BACKGROUND:Malaria elimination requires diagnostic methods able to detect parasite levels well below what is currently possible with microscopy and rapid diagnostic tests. This is particularly true in surveillance of malaria at the population level that includes so-called "asymptomatic" individuals. METHODS:The development of the first ultrasensitive loop mediated amplification method capable of detecting malaria from both whole blood and dried blood spots (DBS) is described. The 18S rRNA and corresponding genes that remain stable on DBS for up to 5 months are targeted. RESULTS:In the case of Plasmodium falciparum, lower limits of detection of 25 parasite/mL and 50-100 parasite/mL from whole blood and DBS were obtained, respectively. A sensitivity of 97.0% (95% CI 82.5-99.8) and specificity of 99.1% (95% CI 97.6-99.7) was obtained for the detection of all species in asymptomatic individuals from Africa and Asia (n = 494). CONCLUSION:This tool is ideally suited for low middle-income countries where malaria is endemic and ultrasensitive surveillance of malaria is highly desirable for elimination.

| S-EPMC6796404 | biostudies-literature

A dual-amplification strategy-intergated SERS biosensor for ultrasensitive hepatocellular carcinoma-related telomerase activity detection.

Project description:Telomerase has been considered as a biomarker for early diagnosis and prognosis assessment of hepatocellular carcinoma (HCC), while the highly sensitive and specific methods remain challenging. To detect telomerase, a novel surface-enhanced Raman scattering (SERS) biosensor was constructed using the dual DNA-catalyzed amplification strategy composed of strand displacement amplification (SDA) and catalytic hairpin assembly (CHA). This strategy relies on the extension reaction of telomerase primer induced by telomerase, forming long-stranded DNAs with repetitive sequence to catalyze the follow-up SDA event. Subsequently, the SDA products can trigger the CHA reaction between the SERS probes (Au-Ag nanocages (Au-AgNCs) modified with hairpin DNA1 and Raman reporters) and capture substrate (Au@SiO2 array labeled with hairpin DNA2), resulting in the formation of numerous "hot spots" to significantly enhance the SERS signal. Results are promising that the established biosensor presented excellent reproducibility, specificity and sensitivity. Moreover, ELISA was applied as the golden standard to verify the application of the proposed biosensor in real samples and the results confirmed the satisfactory accuracy of our method. Therefore, the proposed SERS biosensor has the potential to be an ideal tool for the early screening of HCC.

| S-EPMC9881591 | biostudies-literature

Asymmetric exponential amplification reaction on a toehold/biotin featured template: an ultrasensitive and specific strategy for isothermal microRNAs analysis.

Project description:The sensitive and specific analysis of microRNAs (miRNAs) without using a thermal cycler instrument is significant and would greatly facilitate biological research and disease diagnostics. Although exponential amplification reaction (EXPAR) is the most attractive strategy for the isothermal analysis of miRNAs, its intrinsic limitations of detection efficiency and inevitable non-specific amplification critically restrict its use in analytical sensitivity and specificity. Here, we present a novel asymmetric EXPAR based on a new biotin/toehold featured template. A biotin tag was used to reduce the melting temperature of the primer/template duplex at the 5' terminus of the template, and a toehold exchange structure acted as a filter to suppress the non-specific trigger of EXPAR. The asymmetric EXPAR exhibited great improvements in amplification efficiency and specificity as well as a dramatic extension of dynamic range. The limit of detection for the let-7a analysis was decreased to 6.02 copies (0.01 zmol), and the dynamic range was extended to 10 orders of magnitude. The strategy enabled the sensitive and accurate analysis of let-7a miRNA in human cancer tissues with clearly better precision than both standard EXPAR and RT-qPCR. Asymmetric EXPAR is expected to have an important impact on the development of simple and rapid molecular diagnostic applications for short oligonucleotides.

| S-EPMC5009742 | biostudies-literature

An integrated-molecular-beacon based multiple exponential strand displacement amplification strategy for ultrasensitive detection of DNA methyltransferase activity.

Project description:DNA methylation is a significant epigenetic mechanism involving processes of transferring a methyl group onto cytosine or adenine. Such DNA modification catalyzed by methyltransferase (MTase) plays important roles in the modulation of gene expression and other cellular activities. Herein, we develop a simple and sensitive biosensing platform for the detection of DNA MTase activity by using only two oligonucleotides. The fluorophore labeled molecular beacon (MB) can be methylated by MTase and subsequently cleaved by endonuclease DpnI at the stem, giving a shortened MB. The shortened MB can then hybridize with a primer DNA, initiating a cycle of strand displacement amplification (SDA) reactions. The obtained SDA products can unfold new MB and initiate another cycle of SDA reaction. Therefore, continuous enlargement of SDA and exponential amplification of the fluorescence signal are achieved. Because the triple functions of substrate, template and probe are elegantly integrated in one oligonucleotide, only two oligonucleotides are necessary for multiple amplification cycles, which not only reduces the complexity of the system, but also overcomes the laborious and cumbersome operation that is always a challenge in conventional methods. This platform exhibits an extremely low limit of detection of 3.3 × 10-6 U mL-1, which is the lowest to our knowledge. The proposed MTase-sensing platform was also demonstrated to perform well in a real-time monitoring mode, which can achieve a further simplified and high-throughput detection. The sensing strategy might be extended to the activity detection of other enzymes, thus showing great application potential in bioanalysis and clinical diagnosis.

| S-EPMC6385671 | biostudies-other

Magnetic-Immuno-Loop-Mediated Isothermal Amplification Based on DNA Encapsulating Liposome for the Ultrasensitive Detection of P-glycoprotein.

Project description:Determination of proteins, especially low-abundance proteins with high sensitivity and specificity, is essential for characterizing proteomes and studying their biochemical functions. Herein, a novel Magnetic-Immuno-Loop-Mediated Isothermal Amplification (Im-LAMP) based on DNA-encapsulating liposomes (liposome-Im- LAMP), was developed for trace amounts of proteins. To the best of our knowledge, this is our first report about the magnetic Im-LAMP approach based on liposomes encapsulated template DNA as the detection reagent. The DNA template was released from liposomes and then initiated an Im-LAMP reaction, generating the fluorescence signal with high sensitivity and rapidity. This technique was applied for the determination of P-glycoprotein as a model protein. It was demonstrated that the technique exhibited a dynamic response to P-glycoprotein ranging from 1.6*10-2 to 160?pg/ml with a greatly low detection limit of 5*10-3?pg/ml (5?fg/ml) which is substantially better than conventional enzyme-linked immunosorbent assays (ELISA). This ultra sensitivity was attributed to the LAMP reaction initiated by the enormous DNA targets encapsulated in liposomes. This magnetic liposome-Im-LAMP as an alternative approach is attractive for applications in other low-abundance proteins detection in clinical diagnostics.

| S-EPMC5571029 | biostudies-literature

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence.

Project description:BackgroundThe COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC).ResultThe results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500-5,000, 6,500-7,500, and 23,300-25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests.ConclusionThis study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

| S-EPMC10728416 | biostudies-literature

Quantitative Mammalian Transcriptomics using Designed Primer-based Amplification

Project description:We describe a novel quantitative cDNA expression profiling strategy, involving amplification of the majority of mouse transcriptome using a defined set of 44 heptamer primers. The amplification protocol allows for efficient amplification from as low as 50pg of mRNA and did not alter the expression of the transcripts even with 200 fold dilution of the minimum requirement of the starting material (10ng of mRNA) for standard RNA-seq protocols. We implemented our methodology on embryological lineage segregation, achieved by graded activation of Activin A/TGFβ signaling in mouse embryonic stem cells (mESCs). The fold changes in transcript expression were in excellent agreement with quantitative RT-PCR and we observed a dynamic range spanning more than five orders of magnitude in RNA concentration with a reliable estimation of low abundant transcripts. Our transcriptome data identified key lineage markers, while the high sensitivity showed that novel lineage specific transcripts anticipate the differentiation of specific cell types. We compared our strategy with Std. RNA-seq (Mortazavi et al. 2008) and SMART-seq (Ramsköld et al. 2012). We also showed potential of our methodology to suppress the representation of highly expressing ribosomal transcripts.

2013-04-29 | GSE45474 | GEO

Single-molecule RNA capture-assisted droplet digital loop-mediated isothermal amplification for ultrasensitive and rapid detection of infectious pathogens.

Project description:To minimize and control the transmission of infectious diseases, a sensitive, accurate, rapid, and robust assay strategy for application on-site screening is critical. Here, we report single-molecule RNA capture-assisted digital RT-LAMP (SCADL) for point-of-care testing of infectious diseases. Target RNA was captured and enriched by specific capture probes and oligonucleotide probes conjugated to magnetic beads, replacing laborious RNA extraction. Droplet generation, amplification, and the recording of results are all integrated on a microfluidic chip. In assaying commercial standard samples, quantitative results precisely corresponded to the actual concentration of samples. This method provides a limit of detection of 10 copies mL-1 for the N gene within 1 h, greatly reducing the need for skilled personnel and precision instruments. The ultrasensitivity, specificity, portability, rapidity and user-friendliness make SCADL a competitive candidate for the on-site screening of infectious diseases.

| S-EPMC10519972 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data